View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18433_low_31 (Length: 249)
Name: NF18433_low_31
Description: NF18433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18433_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 34816245 - 34816452
Alignment:
| Q |
19 |
aaattgcgatcgttgaggatatatatgttagtctcagtggtagagtcgttcacatcaattctattttgggttctatcccaatatcattaatgagagtact |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34816245 |
aaattgcgatcgttgaggatacatatgttagtctcagtggtagagttgttcacatcaattctattttgggttctatcccaacatcattaatgagagtact |
34816344 |
T |
 |
| Q |
119 |
actgcaagggtgattctcattgcaaaaggtgccttatatgccaagtacaaagttagtattgtggctaactcggatttatctaattttgacagattgagtc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34816345 |
gctgcaagggtgattctcattgcaaaaggtgcc--gtatgccaagtacaaagttggtattgtggctaactcggatttatctaattttgacagattgagtc |
34816442 |
T |
 |
| Q |
219 |
tagcttcatt |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
34816443 |
tagcttcatt |
34816452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University