View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18434_high_2 (Length: 416)
Name: NF18434_high_2
Description: NF18434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18434_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 19 - 415
Target Start/End: Original strand, 32225670 - 32226066
Alignment:
| Q |
19 |
tatgggtcaacgatagctttgattatatcatatacgcgttactcattgaattaaaaaagttgattttacgggtcaacggacacttcaagatgggatctcg |
118 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32225670 |
tatgggtcaacggtagctctgattgtatcatatacacgttactcattgaattaaaaaagttgattttatgggtcaacggacacttcaagatgggatctcg |
32225769 |
T |
 |
| Q |
119 |
atcatttataaagatcggacaactgtcattctaacttcccaatttgcgaaagtcacgtgagtcatctgatctctgttcaataacttagatcgacttgatt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32225770 |
atcatttataaagatcggacaactgtcattctaacttcccaatttgcgaaagtcacgtgagtcatctgatctctgtccaataacttagatcgacttgatt |
32225869 |
T |
 |
| Q |
219 |
gagtgatcacaagaactattgactatagattgtctttatcttagtcaatgtctagtccttggaagctgaaaactcctacttttggttccctaaatatttg |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32225870 |
gagtgatcacaagaactattgactatagattgtctttatcttagtcaatgtctagtccttggaagctgaaaactcctacttttggttccctaaatatttg |
32225969 |
T |
 |
| Q |
319 |
gtggtgtgggaatttgtgtatttcaagatagccataaggcatgctagacaatgctttgggcactctgcctctttaccaccgttactctctgctgctc |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
32225970 |
gtggtgtgggaatttgtgtatttcaagatagccataaggcgtgctagacaatgctttgggcactctgcctctttaccaccgttactctttgatgctc |
32226066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University