View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18434_low_5 (Length: 272)
Name: NF18434_low_5
Description: NF18434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18434_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 8736635 - 8736381
Alignment:
| Q |
1 |
aaatttagttgaaagaggaggacttgtcttgcattgtannnnnnnnnatatagatttttcgatgaagattagtcattattaaacgaaggtgtaaacttta |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8736635 |
aaatttagttgaaagaggaggatttgtcttgcattgtatttttttt--tatagatttttcgatgaagattagtcattattaaacgaaggtgtaaacttta |
8736538 |
T |
 |
| Q |
101 |
aatctnnnnnnnnnnnnnntaattgctgaaaaacataggttatatatttttcgcctatttaaaaattagaatataagcaattacattagtctatcttttg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||||||| |||||||||||| | ||||||||||||||| || ||| |
|
|
| T |
8736537 |
aatctaaaaaactaaaaaataattgctgaaaaacataggttatatatatt-cgcctatttagaaattagaatatgaacaattacattagtctggctcttg |
8736439 |
T |
 |
| Q |
201 |
gaaattgctcgtaagaatgctttaaaagaaactccaagcaaatctatacaaccttatg |
258 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8736438 |
gaaattgcacgtaagaatgctttaaaagaaactccaagcaaatctatacaaccttatg |
8736381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University