View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18435_low_8 (Length: 348)
Name: NF18435_low_8
Description: NF18435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18435_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 21 - 331
Target Start/End: Original strand, 37215954 - 37216263
Alignment:
| Q |
21 |
accacccttcacactaacaaccaccactactcacatgtcctcacttccctctctacaacccctttgacaacattaacaccttccttaccacacgcggact |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37215954 |
accacccttcacactaacaaccaccactactcacatgccctcacttccctctctacaacccctttgacaaaattaacaccttccttaccacacgcggact |
37216053 |
T |
|
| Q |
121 |
ccctttataacatgtaatcccacctctttctccacccttcatctcagataaaacaataacaataataaccttgcaacctttgtattttaccccaatagac |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37216054 |
ccctttataacatgtaatcccccctctttctccacccttcatcttagataaaacaataacaataataaccttgcaacctttgtattttaccccaatagac |
37216153 |
T |
|
| Q |
221 |
ttatcaatccttcatgcattcatccattgtgacttcatgtttatcacgtaaaaccatcaaaattttcatatcacaattaaccgataaataagaactacta |
320 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37216154 |
ttatcaatccttcatgca-tcatctattgtgacttcatgtttatcacgtaaaaccatcaaaattttcatatcacaattaaccgataaataagaactacta |
37216252 |
T |
|
| Q |
321 |
gaagataattg |
331 |
Q |
| |
|
||||||||||| |
|
|
| T |
37216253 |
gaagataattg |
37216263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University