View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18436_high_15 (Length: 209)
Name: NF18436_high_15
Description: NF18436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18436_high_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 15 - 193
Target Start/End: Original strand, 34723114 - 34723292
Alignment:
| Q |
15 |
catagggtctaaagccataaatgggaataaatagtgtaaaggtaacacaaccaaacacagcacttccagttgtaatggttatttgatagtagagtacagt |
114 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34723114 |
catagagtctacagccataaatgggaataaatagtgtaaaggtaacacaaccaaacacagcacttccagttgtaatggttatttgatagtagagtacagt |
34723213 |
T |
|
| Q |
115 |
gagattcttaacggttaaacttgttcatttattattactttatatacaaaaatgaaatgtaattgagaaaagaagaaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
34723214 |
gagattcttaacggttaaacttgttcatttattattactttatctacaaaaaggaaatgaaattgagaaaagaagaaaa |
34723292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University