View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18436_low_15 (Length: 227)
Name: NF18436_low_15
Description: NF18436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18436_low_15 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 31884529 - 31884750
Alignment:
| Q |
6 |
aaaaaacacatgcgaaaatttgatttcaaatcaaattttccaaactagttatgaaacaccatgcttgcttgctatgtgaagaggacgacctaggaaagat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31884529 |
aaaaaacacatgcgaaaatttgatttcaaatcaaattttccaaactagttatgaaacaccatgcttgcttgctatgtgaagaggacgacctaggaaagat |
31884628 |
T |
|
| Q |
106 |
gtcaacacaacttcgctgtgagatggaaaggaacgtgaaagttagggaacttctttttatgttggaaagtgatggaagattgtgctatgaagataatagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31884629 |
gtcaacacaacttcgctgtgagatggaaaggaacgtgaaagttagggaacttctttttatgttggaaagtgatggaagattgtgctatgaagataatagt |
31884728 |
T |
|
| Q |
206 |
tgaaatcaacttttgaaaatga |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31884729 |
tgaaatcaacttttgaaaatga |
31884750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University