View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18437_high_3 (Length: 374)
Name: NF18437_high_3
Description: NF18437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18437_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 2 - 237
Target Start/End: Original strand, 55118811 - 55119046
Alignment:
| Q |
2 |
gaagcatgtggaggctcgttgggaagctgaattcgttaaggttgatcgtaaggttaagaagcatgtcgatgatctcaaggcttgggacactgaattcatg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55118811 |
gaagcatgtggaggctcgttgggaagctgaattcgttaaggttgatcgtaaggttaagaagcgtgtcgatgatctcaaggcttgggacgctgaattcatg |
55118910 |
T |
 |
| Q |
102 |
aagcaggttgatcaggatacccttaacgatctccttctagctgcaaattacttgaacatcaaggaattgctggatcttacttgtccggctatagtggacg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
55118911 |
aagcaggttgatcaggatacccttaacgatctccttctagctgcaatttacttgaacatcaaagaattgctggatcttacttgtccggctatagtggaag |
55119010 |
T |
 |
| Q |
202 |
ctcgtaggagagacacattgttcttgtttcttattc |
237 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
55119011 |
ctcgtaggagagacacattgtttgtgtttcttattc |
55119046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 315 - 363
Target Start/End: Original strand, 55119125 - 55119173
Alignment:
| Q |
315 |
cggattatttgggttgacttgtgtgtctcttctggtttattagaccttt |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
55119125 |
cggattatttgggttgacttgtgtgtctcttctggtttgttagaccttt |
55119173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 69 - 164
Target Start/End: Original strand, 37580881 - 37580976
Alignment:
| Q |
69 |
gatgatctcaaggcttgggacactgaattcatgaagcaggttgatcaggatacccttaacgatctccttctagctgcaaattacttgaacatcaag |
164 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||| |||||||||| || ||| ||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
37580881 |
gatgatcttaaggcttgggacgctgaattcatgaagcatgttgatcaggctatgcttttcgaactcattcaagctgcaaattacttgaacatcaag |
37580976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 106 - 164
Target Start/End: Original strand, 6778617 - 6778675
Alignment:
| Q |
106 |
aggttgatcaggatacccttaacgatctccttctagctgcaaattacttgaacatcaag |
164 |
Q |
| |
|
|||||||||||||||| ||| ||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
6778617 |
aggttgatcaggatacacttttcgatctcattcttgctgcaaattacttgaatatcaag |
6778675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 106 - 164
Target Start/End: Complemental strand, 37476301 - 37476243
Alignment:
| Q |
106 |
aggttgatcaggatacccttaacgatctccttctagctgcaaattacttgaacatcaag |
164 |
Q |
| |
|
||||||||||||||| ||| ||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
37476301 |
aggttgatcaggataaacttttcgatctcattcttgctgcaaattacttgaatatcaag |
37476243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University