View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18437_high_6 (Length: 289)
Name: NF18437_high_6
Description: NF18437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18437_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 266
Target Start/End: Complemental strand, 28035922 - 28035657
Alignment:
| Q |
1 |
tttgaagatcctgaaacaaaggcacaaatgaaagcaatggcagctagagctttatggcaattgtgtagaagaaatgttactatttgtcatacaattacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035922 |
tttgaagatcctgaaacaaaggcacaaatgaaagcaatggcagctagagctttatggcaattgtgtagaagaaatgttactatttgtcatacaattacag |
28035823 |
T |
 |
| Q |
101 |
aatcaagagctcttttgtgtttcgcggttttgttggaaaagggtacagatgatgtgcaacattattcagcaatggctttgatggaaataacatctgtggc |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035822 |
aatcaagagctcttttgtgttttgcggttttgttggaaaagggtactgatgatgtgcaacattattcagcaatggctttgatggaaataacatctgtggc |
28035723 |
T |
 |
| Q |
201 |
agcagaacatgcagaattgagacgctctgctttcaaaccaactgcccctgctgcaaaagctgtggt |
266 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28035722 |
agcagaacatgcagaattgagacgttctgctttcaaaccaactgcccctgctgcaaaagctgtggt |
28035657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University