View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18438_low_10 (Length: 311)
Name: NF18438_low_10
Description: NF18438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18438_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 3288847 - 3289017
Alignment:
| Q |
17 |
caattctttcaatgtaatatgatcaaattattttcaagaaatccacagtccattttgtttcggtcttgtcttgacaatttttagggatgataaaactctt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3288847 |
caattctttcaatgtaatatgatcaaattattttcaagaaatccacagtccattttgtttcggtcttgtcttgacaatttttatggatgataaaactctt |
3288946 |
T |
|
| Q |
117 |
tcatttgtagttattgtagagatttgacatgttcaaacaagatgaataaatatatttgttaagtggtacta |
187 |
Q |
| |
|
| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
3288947 |
taatttgtagttattgtagagatttgacatgtccaaacaagatgaataaatctatttgtcaagtggtacta |
3289017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 295
Target Start/End: Original strand, 3289056 - 3289142
Alignment:
| Q |
219 |
tagtttaataattaaaaaatctctttaaata----------gagaattcaggattcgaatatcaactttacatatcgtaacgtctct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
3289056 |
tagtttaataattaaaaaatctctttaaagatgaatacgaagagaattcaggattcgaatctcaaccttacatatcgtaacgtctct |
3289142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University