View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18438_low_13 (Length: 244)
Name: NF18438_low_13
Description: NF18438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18438_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 64 - 236
Target Start/End: Complemental strand, 6306817 - 6306645
Alignment:
| Q |
64 |
ttggaatatttattggttactgcattattgatgctgttagatagcaaagagttatcagaccaatgatacatgatactagagacttgttttgaactaatcg |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
6306817 |
ttggaatatttattggttactgcattattgatgttgttagatagtaaagagttatcagaccaatgatacatgatactagagacttgttatgaactgatcg |
6306718 |
T |
|
| Q |
164 |
caaaatatttgtatgccttctatcatttctgcaccaaattaggcatcagcatataggttatgatagtattatc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6306717 |
caaaatatttgtatgccttctatcatttctgcaccaaattagacatcagcatataggttatgatagtattatc |
6306645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University