View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18438_low_16 (Length: 211)
Name: NF18438_low_16
Description: NF18438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18438_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 2429380 - 2429557
Alignment:
| Q |
19 |
acattcaacatcagggtatgcggaaagcagttcgtgggcttctcttcaattttgtcaacaataaggtatttttatatgactgaaaatttaaataaactat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429380 |
acattcaacatcagggtatgcggaaagcagttcgtgggcttctcttcaattttgtcaacaataaggtatttttatatgactgaaaatttaaataaactat |
2429479 |
T |
 |
| Q |
119 |
ttttcaatttcaaagcaaggtaaatgatggtcaaannnnnnnnctcttcccgtgtaggttgtaatatcccagttcatc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429480 |
ttttcaatttcaaagcaaggtaaatgatggtcaaattttttttctcttcccgtgtaggttgtaatatcccagttcatc |
2429557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 93 - 122
Target Start/End: Complemental strand, 1512344 - 1512315
Alignment:
| Q |
93 |
tatgactgaaaatttaaataaactattttt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1512344 |
tatgactgaaaatttaaataaactattttt |
1512315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University