View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18438_low_7 (Length: 437)
Name: NF18438_low_7
Description: NF18438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18438_low_7 |
 |  |
|
| [»] chr1 (116 HSPs) |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0692 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (2 HSPs) |
 |  |  |
|
| [»] scaffold1318 (1 HSPs) |
 |  |  |
|
| [»] scaffold0491 (1 HSPs) |
 |  |  |
|
| [»] scaffold1284 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |  |
|
| [»] scaffold0392 (1 HSPs) |
 |  |  |
|
| [»] scaffold0570 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0245 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold1259 (1 HSPs) |
 |  |  |
|
| [»] scaffold0221 (1 HSPs) |
 |  |  |
|
| [»] scaffold0045 (1 HSPs) |
 |  |  |
|
| [»] scaffold1858 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 406; Significance: 0; HSPs: 116)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 406; E-Value: 0
Query Start/End: Original strand, 11 - 437
Target Start/End: Complemental strand, 2429961 - 2429535
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatacttccacctttcagaattttaaaacaatattgaattgcagaattgcagtta |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429961 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatacttccacctttcagaattttaaaacaatattgaattgcagaattgcagtta |
2429862 |
T |
 |
| Q |
111 |
aataacaaaactagtgtggagacagagatatacatgatggtgattcttcgccagctttttgataatttttgcagcctcactaggatcatcatcctacatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429861 |
aataacaaaactagtgtggagacagagatatacatgatggtgattcttcgccagctttttgataatttttgcagcctcactaggatcatcatcctacatc |
2429762 |
T |
 |
| Q |
211 |
aaatnnnnnnntaattcaggaaaacgcagatttttcacactggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgacc |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429761 |
aaataaaaaaataattcaggaaaacgcagatttttcacactggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgacc |
2429662 |
T |
 |
| Q |
311 |
ccacttagtgggacaaagcttggttgatatagacatgagatactaacataataaccaaaagtgcctcctttcagttccaaaattgtttcaaaccagcctc |
410 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429661 |
ccacttagtgggacaaagcttggttgatatagacatgagatactaacataataaccaaaagtgcctcctttcagttccaaaattgtttcaaaccagcctc |
2429562 |
T |
 |
| Q |
411 |
cagtgatgaactgggatattacaacct |
437 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2429561 |
cagtgatgaactgggatattacaacct |
2429535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 41560435 - 41560504
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
41560435 |
ttatgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
41560504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 8796414 - 8796484
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
8796414 |
tttatgatagaacattatggcgtaatttaatccatgtagccgaccccacttagtgggataaggcttggttg |
8796484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 28090771 - 28090701
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
28090771 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataagacttggttg |
28090701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 37462953 - 37462883
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
37462953 |
tttatcatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
37462883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 44941853 - 44941783
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
44941853 |
tttatgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
44941783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 52532693 - 52532623
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52532693 |
tttatgatagaacattatggcgtaatttgattcatgtagccgaccccacttagtgggaaaaggcttggttg |
52532623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 21769784 - 21769718
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
21769784 |
tgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgtgataaggcttggttg |
21769718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 25715403 - 25715333
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||| || ||||||||| |
|
|
| T |
25715403 |
tttatgatagaatattatggcgtaatttgatccatgtagccgacctcacttagtgggataaggcttggttg |
25715333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 25979308 - 25979238
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
25979308 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
25979238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 38807748 - 38807678
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38807748 |
tttatgatagaacactatggcgtaatttgttccatgtagccgaccccacttagtgggataaggcttggttg |
38807678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 17269066 - 17269009
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
17269066 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccatttagtggga |
17269009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 28511878 - 28511821
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
28511878 |
tttatgatagaacattatggcgtaatttgatcaatgtagccgaccccacttagtggga |
28511821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 39140725 - 39140790
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
39140725 |
gatagaacattatggcgtaatttgattcatgtagccgaccccacttagtgggataatgcttggttg |
39140790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 1210952 - 1211020
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
1210952 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
1211020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 328
Target Start/End: Original strand, 27704157 - 27704217
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaag |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
27704157 |
tatgatagaacattatggcgtaatttgatccatgtagccgaccccgcttagtgggaaaaag |
27704217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 29577459 - 29577527
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
29577459 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
29577527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 30202205 - 30202137
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30202205 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
30202137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 38869089 - 38869157
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38869089 |
tatgatagaacattatggcgtcgtttgatccatgtagccgaccccacttagtgggaaaatgcttggttg |
38869157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 49347468 - 49347400
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
49347468 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
49347400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 256 - 336
Target Start/End: Original strand, 50846757 - 50846837
Alignment:
| Q |
256 |
caaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |||||||||| | ||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
50846757 |
caaaatatagtttatgatagaacattatggcataatttgatctatgtagccgacaccacttagtgggaaaatgcttggttg |
50846837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 273 - 336
Target Start/End: Complemental strand, 52561659 - 52561596
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52561659 |
tagaacattatggcgaaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
52561596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 2544798 - 2544868
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||| ||||||||||||||||||||| | || ||||||||| |
|
|
| T |
2544798 |
tttataatagaacattatggcataatttgatccatgtagccgaccccacttagtggtaaaaggcttggttg |
2544868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 4707297 - 4707228
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4707297 |
tttatgatagaacactatggcgtaatttgatc-atgtagccgaccccacttagtgggataaggcttggttg |
4707228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 22175350 - 22175420
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
22175350 |
tttatgatagaacattatggtagaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
22175420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 27072564 - 27072494
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |||||||||| || ||||||||| |
|
|
| T |
27072564 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccatgcttagtgggaaaaggcttggttg |
27072494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 34792426 - 34792356
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
34792426 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttg |
34792356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 37311828 - 37311762
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
37311828 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttg |
37311762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 40568487 - 40568417
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
40568487 |
tttatgatagaaaactatggcgtaatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
40568417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 52921285 - 52921355
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52921285 |
tttatgatagaacactattgcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
52921355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 32404603 - 32404546
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32404603 |
tttatgatataacataatggcgtaatttgatccatgtagccgaccccacttagtggga |
32404546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 37294185 - 37294128
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||| ||||||||| |
|
|
| T |
37294185 |
tttatgatagaacattatggcgtaatttgatccatgtagctgaccccatttagtggga |
37294128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 271 - 336
Target Start/End: Complemental strand, 38877415 - 38877350
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |||||||||||||| || ||||||||| |
|
|
| T |
38877415 |
gatagaacattatggcgtcatttgatccatgtagccgaacccacttagtgggataaggcttggttg |
38877350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 32112064 - 32111996
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||| |||||||||| ||| || ||||||||| |
|
|
| T |
32112064 |
tatgatagaacattatggcgtaatttgatcaatgtagccgaacccacttagttggaaaaggcttggttg |
32111996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 44751691 - 44751759
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||| |||||||||||| || ||||||||| |
|
|
| T |
44751691 |
tatgatagaacactatggcgtcatttgatccatgtagccgacctcacttagtgggataaggcttggttg |
44751759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 338
Target Start/End: Complemental strand, 45510910 - 45510838
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttgat |
338 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||| ||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
45510910 |
tttatgatagaacaccatagcgtaatttaatccatgtagccgaccccacttagtgggataaagcttggctgat |
45510838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 51602263 - 51602331
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
51602263 |
tatgatagaacatcatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
51602331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 7133376 - 7133309
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||| |||||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
7133376 |
atgatagaacattttggcctaatttgatccatgtagctgaccccacttagtgggaaaaggcttggttg |
7133309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 4590605 - 4590539
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| || | ||||||| |
|
|
| T |
4590605 |
tgatagaacaatatggtgtaatttgatccatgtagccgaccccacttagtgggataaggtttggttg |
4590539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 10200383 - 10200313
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||| |||||||||| |||||| ||||| || ||||||||| |
|
|
| T |
10200383 |
tttatgatagaacatcatggtgtaatttgatccatgtagccgacctcacttaatgggataatgcttggttg |
10200313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 19908112 - 19908046
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||| ||||||||| ||||||||| ||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
19908112 |
tttatgattgaacattattgcgtaattttatccatgtagccgaccccacttagtgggataaggcttg |
19908046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 29888765 - 29888855
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
29888765 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
29888855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 34444561 - 34444631
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||| |||||||||| ||||||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
34444561 |
tttataataaaacattatggtgtaatttgatctatgtagccgaccccacttagtgggataaggcttggttg |
34444631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 50257775 - 50257829
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
50257775 |
tttatgatagaacattatggtgtaatttgatccatgtagccaaccccacttagtg |
50257829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 52607404 - 52607314
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
52607404 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
52607314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 275 - 336
Target Start/End: Complemental strand, 2914191 - 2914130
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
2914191 |
gaacattatggcgtactttgatccatgtagccaaccccacttagtgggataaggcttggttg |
2914130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 14557773 - 14557826
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||| |||||||||| |
|
|
| T |
14557773 |
tttatgatagaacattatggcgtattttgatccacgtggccgatcccacttagt |
14557826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 26113516 - 26113459
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| | |||||||||||| |
|
|
| T |
26113516 |
tttatgatagaacattatggcttaatttgatccatgtagccgagctcacttagtggga |
26113459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 28533673 - 28533742
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
28533673 |
ttatgatagaacactatgacgtcatttgatccatgtagccgaccccacttagtgggataagacttggttg |
28533742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 41165500 - 41165557
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
41165500 |
attatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttg |
41165557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 9592941 - 9593009
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
9592941 |
tatgatagaacactatagcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttg |
9593009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 22090303 - 22090371
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||| ||||||| || ||||||||| |
|
|
| T |
22090303 |
tatgatagaacactatgacgtcatttgatccatgtagccgaccccactaagtgggataaggcttggttg |
22090371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 265 - 321
Target Start/End: Complemental strand, 39123446 - 39123391
Alignment:
| Q |
265 |
ttttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |||||||||||| |||||||| |
|
|
| T |
39123446 |
ttttatgatagaacattatggtgtaatttgatccatgtagccgacccc-cttagtgg |
39123391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 42337763 - 42337831
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
42337763 |
tatgatagaacactatggcatcatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
42337831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 26299288 - 26299343
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
26299288 |
tatggcgtaatttgatccatgtagccgaccccacttagtgggataagacttggttg |
26299343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 43375672 - 43375605
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| | |||||||||||| |||||| | |||||||||||||| |||| ||||||| |
|
|
| T |
43375672 |
atgatagaacattatgacataatttgatccatgtagccaatcccacttagtgggataaagattggttg |
43375605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 1290108 - 1290038
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||||||| ||| ||| || |||| |||| |
|
|
| T |
1290108 |
tttatgatagaacattatggcataatttgatccatgtggccgaccccactcagttggataaggcttagttg |
1290038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 4318906 - 4318852
Alignment:
| Q |
282 |
atggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4318906 |
atggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttg |
4318852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 5338918 - 5338972
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||| ||| ||||||||| |
|
|
| T |
5338918 |
tttattatagaacattatggcgtaatttgatccatgtagccaacctcacttagtg |
5338972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 15086131 - 15086197
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
15086131 |
tgatagaacactatgacgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
15086197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 19936668 - 19936722
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||| || |||||||||| |
|
|
| T |
19936668 |
atgatagaacattacggcgtaatttgatccatgtagccgactccgcttagtggga |
19936722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 24020344 - 24020274
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| | |||| ||||||||| |||||| || ||||||||| |
|
|
| T |
24020344 |
tttatgatagaacactatggcgtcatttgatccatgcagccaaccccactttgtgggataaggcttggttg |
24020274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 29128988 - 29129058
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgat-ccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| ||| |||||||||||||||||||| || || |||||||| |
|
|
| T |
29128988 |
tttatgatagaacattatggtgtaatatgatcccatgtagccgaccccacttagtgagataaggcttggtt |
29129058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 31274478 - 31274408
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
31274478 |
tttatgatataacgttatggcgtaatttgatctgtgtagctgaccccacttagtgggataatgcttggttg |
31274408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 332
Target Start/End: Original strand, 39318334 - 39318399
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||| ||| |||||||||| || ||||| |
|
|
| T |
39318334 |
tttatgatagaacactatggcgtaatttgatccatgtagccga-cccgcttagtgggataaggcttg |
39318399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 335
Target Start/End: Complemental strand, 42539290 - 42539220
Alignment:
| Q |
266 |
tttatgatagaacattat-ggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||||||||| || || ||||||||||||| |||| |||||||||||||||||| || |||||||| |
|
|
| T |
42539290 |
tttatgatagaacatcattggtgtaatttgatccatgtagacgaccccacttagtgggaaaaggcttggtt |
42539220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 52292244 - 52292314
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||| ||| || |||||||||||||||| || ||||||||| |
|
|
| T |
52292244 |
tttatgatagaaaattattgagtaatttgatccatgtaaccaaccccacttagtgggataaggcttggttg |
52292314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 6084165 - 6084250
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||| ||| || | |||||||||||| || ||||||||| |
|
|
| T |
6084165 |
tggatcaaaatatggtttatgatagaacaatatggcgtaatttgatccatgtatttgatctcacttagtgggataaggcttggttg |
6084250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 9599471 - 9599414
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
9599471 |
tttatgatagaacgttatggcgtaatttgatccatgtagctgaccttacttagtggga |
9599414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 287 - 336
Target Start/End: Complemental strand, 43481854 - 43481805
Alignment:
| Q |
287 |
gtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
43481854 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
43481805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 4029329 - 4029397
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||| ||||||| |||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
4029329 |
tatgatataacactatggcgacatttgatccatgtagccgaccccacttagtgggataagacttggttg |
4029397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 334
Target Start/End: Complemental strand, 27847877 - 27847809
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||| |||||||||| |||||||| ||||| |||||||| | |||||||||||| || ||||||| |
|
|
| T |
27847877 |
tttatgatggaacattatgccgtaattttatccatgtagccgatctcacttagtgggataaggcttggt |
27847809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 322
Target Start/End: Original strand, 40416576 - 40416632
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||| ||||||||||||||||||||| |
|
|
| T |
40416576 |
tttatgatagaacattatggtgtaatgtgatccctttagccgaccccacttagtggg |
40416632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 43240454 - 43240386
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || |||||||||| |||||||||||| || |||| |||| |
|
|
| T |
43240454 |
tatgatagaacactatggcgtcatttgattcatgtagccgacctcacttagtgggataaggcttagttg |
43240386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 49377508 - 49377576
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||| ||||||||| || ||||||||| |
|
|
| T |
49377508 |
tatgatagaacattatggcggtgtttgatccatgtagccgactccagttagtgggataaggcttggttg |
49377576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 335
Target Start/End: Complemental strand, 109068 - 109002
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||| ||||| |||||||| ||||||||||| |
|
|
| T |
109068 |
tatgatagaacattatggcgtcatttgatccatgtagcctgtcccac-tagtgggataaagcttggtt |
109002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 696478 - 696545
Alignment:
| Q |
270 |
tgatagaacattat-ggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||| ||||| |||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
696478 |
tgatagaacactattggcgtcatttgatcaatgtagccgaccccacttagtgggataaggcttggttg |
696545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 256 - 323
Target Start/End: Complemental strand, 2694506 - 2694439
Alignment:
| Q |
256 |
caaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||| | |||||||||||||||||||| || ||||||||| |||| ||||||||||||||||| |
|
|
| T |
2694506 |
caaaatatagtttatgatagaacattatggtatagtttgatccatttagcagaccccacttagtggga |
2694439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 36339878 - 36339811
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||||||| ||||||||||||| ||||| ||| ||||||||||||| || ||||||||| |
|
|
| T |
36339878 |
atgataaaacattatgaagtaatttgatccatgtagctgactccacttagtgggaaaatgcttggttg |
36339811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 6025814 - 6025880
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| ||||||| |||||||||| |||||||| ||||||||||||| || |||||||| |
|
|
| T |
6025814 |
tgatagaacatgatggcgtcatttgatccatgtagccgattccacttagtgggataatacttggttg |
6025880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 312
Target Start/End: Original strand, 9509523 - 9509569
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgacccc |
312 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
9509523 |
tttatgattgaacattatggcgtaattcgatccatgtagccgacccc |
9509569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 11941657 - 11941587
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||| |||| || || |||||||||||| | ||||||||| |
|
|
| T |
11941657 |
tttatgataaaacattatggcgtattttgatccatgtagtcggcctcacttagtgggatacggcttggttg |
11941587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 37429976 - 37429906
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||| ||||||||||||| ||| ||||| || | ||||||| |
|
|
| T |
37429976 |
tttatgatagcacattgtggtgtaatttgatccatgtagccgaccccatttaatgggataagggttggttg |
37429906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 46423277 - 46423223
Alignment:
| Q |
282 |
atggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
46423277 |
atggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
46423223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 48865784 - 48865730
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||| |||||| |||||||| |||| |
|
|
| T |
48865784 |
tttatgatagaatattatggtgtaatttgatccatgtagccaaccccactcagtg |
48865730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 52981484 - 52981414
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||| |||||| ||||||||| |||||| || | ||||||| |
|
|
| T |
52981484 |
tttatgatagaatattatggtgtaatttgatccttgtagccaaccccacttggtgggataacgattggttg |
52981414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 18469159 - 18469102
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||| ||||||||||| |||||||| | || |||| |||||||||||||||||| |
|
|
| T |
18469159 |
tttatgatcgaacattatggtgtaatttggttcatgtagacgaccccacttagtggga |
18469102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 267 - 336
Target Start/End: Complemental strand, 29577219 - 29577150
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| |||||| | || |||||| |||||||||||||||| | ||||||||| |
|
|
| T |
29577219 |
ttatgatagaacattatggcataatttatttcatgtagccaaccccacttagtgggatagtgcttggttg |
29577150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 1704834 - 1704886
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
||||||||||||| ||||| |||||||||||| || || |||||||||||||| |
|
|
| T |
1704834 |
tatgatagaacatcatggcataatttgatccatgttgctgaccccacttagtg |
1704886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 334
Target Start/End: Complemental strand, 3818933 - 3818865
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||| |||||||||| || |||||||||| ||||||||| |||||||||||| || ||||||| |
|
|
| T |
3818933 |
tttatgatggaacattatgtcgccatttgatccatgtagccgactgcacttagtgggataaggcttggt |
3818865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 8672125 - 8672193
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||| |||||||||||| ||| || ||||||||| |
|
|
| T |
8672125 |
tatgatagaacactatagcgtcatttgatccatatagccaaccccacttagtaggataaggcttggttg |
8672193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 318
Target Start/End: Complemental strand, 12930388 - 12930336
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttag |
318 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
12930388 |
tttatgatagaagattatgacgtaatttgatccgtgtagccaaccccacttag |
12930336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 16943362 - 16943430
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||||||| ||||| || || ||||||||| |
|
|
| T |
16943362 |
tatgatagaacattatggcggcgtttgatccatgtagtcgaccccacctagtgagataatgcttggttg |
16943430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 30396804 - 30396736
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
30396804 |
tatgatagaacattatggtggcgtttgatccgtgtagccaaccccacttagtgggataaggcttggttg |
30396736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 37430487 - 37430427
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| ||||||||||| || || ||||||||| |
|
|
| T |
37430487 |
aacattatggcgtagtttgatccatatagccgatcccacttagtgagataaggcttggttg |
37430427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 51440840 - 51440772
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| || ||||| ||||||| || ||| ||||||||||||||||||| || |||||||| |
|
|
| T |
51440840 |
tatgatagaacactacggcgtcatttgattcatgtaaccgaccccacttagtgggataagacttggttg |
51440772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 332
Target Start/End: Complemental strand, 52073123 - 52073059
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||| |||||| || ||||| |
|
|
| T |
52073123 |
tatgatagaacattatggcggcgattgatccatgtagccgaccccacttggtgggataaggcttg |
52073059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 14225911 - 14225856
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| ||||| || ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
14225911 |
tatgatagaacagtatggtgtcgtttgatccatgtagccggccccacttagtggga |
14225856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 32079252 - 32079184
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| | ||||| |||||||| | |||||||||||||||| |||||| || ||||||||| |
|
|
| T |
32079252 |
tttatgatagaacact--ggcgtcatttgatcgatgtagccgaccccacttggtgggataaggcttggttg |
32079184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 335
Target Start/End: Original strand, 42501315 - 42501382
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||||||||| |||| ||| ||||| ||||||||||| ||||||||||| |||| |||||| |
|
|
| T |
42501315 |
tatgatagaacattacagcgtcgtttaatccatgtagccgaccctacttagtgggataaagtttggtt |
42501382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 290 - 336
Target Start/End: Complemental strand, 4001508 - 4001462
Alignment:
| Q |
290 |
atttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
4001508 |
atttgatccatgtagccaaccccacttagtgggaaaaggcttggttg |
4001462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 281 - 323
Target Start/End: Complemental strand, 7210989 - 7210947
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||| |||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7210989 |
tatggcataatttgatccatgtaaccgaccccacttagtggga |
7210947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 322
Target Start/End: Complemental strand, 8676937 - 8676883
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| ||||||||| || |||||||| |
|
|
| T |
8676937 |
tatgatagaatattatggcataatttgatccatgtagccgactccggttagtggg |
8676883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 323
Target Start/End: Complemental strand, 32082830 - 32082776
Alignment:
| Q |
270 |
tgatagaacattatggc-gtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||| || ||| || |||||||||| ||||||||||||||||||||||| |
|
|
| T |
32082830 |
tgatagaacactacggcagtcatttgatccatgtagccgaccccacttagtggga |
32082776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 35828639 - 35828569
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||||||||||||||| |||||||||| ||| |||||||| |||||||||| || |||||||| |
|
|
| T |
35828639 |
tttacgatagaacattatggcaatatttgatccatgtaaccgaccccgcttagtgggaaaagacttggttg |
35828569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 48431472 - 48431406
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||||| ||||| ||||||||||| ||||| ||||||||||||| ||| || ||||||||| |
|
|
| T |
48431472 |
tgataaaacatcatggcttaatttgatccttgtagctgaccccacttagtaggataaggcttggttg |
48431406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 272 - 321
Target Start/End: Original strand, 4415560 - 4415609
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||| ||| ||||||| |
|
|
| T |
4415560 |
atagaacattatggcatcatttgatccatgtagccgactccatttagtgg |
4415609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 7082509 - 7082566
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||| |||||||||| || |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
7082509 |
tttattatagaacattttgtggtaaactgatccatgtagccgaccccacttagtggga |
7082566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 8203206 - 8203157
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||||||||| || ||||| |||||||||||||||||||| |
|
|
| T |
8203206 |
gatagaacattatggcgttgatttatccatgtagccgaccccacttagtg |
8203157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 319
Target Start/End: Original strand, 8391981 - 8392030
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
|||||||| | |||||||| |||||||||| |||||| |||||||||||| |
|
|
| T |
8391981 |
tgatagaatactatggcgtcatttgatccatgtagccaaccccacttagt |
8392030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 281 - 318
Target Start/End: Original strand, 52815095 - 52815132
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttag |
318 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
52815095 |
tatggcgtaatttgatccatgtagccgaccccgcttag |
52815132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 5113950 - 5114018
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| || |||||||||| || ||||||||| || | ||||||| |
|
|
| T |
5113950 |
tatgatagaacactatgacgtcatttgattcatgtagccgacctcaattagtgggataacgtttggttg |
5114018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 267 - 331
Target Start/End: Original strand, 7083096 - 7083160
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagctt |
331 |
Q |
| |
|
||||||||||||| |||||||| |||||| || ||||| |||||| ||||||||| ||||||| |
|
|
| T |
7083096 |
ttatgatagaacactatggcgtcgtttgattcatgtagctgaccccgcttagtgggttaaagctt |
7083160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 266 - 334
Target Start/End: Complemental strand, 19908461 - 19908393
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
||||| |||||| |||| ||||| ||||||||| ||| | ||||||||||||||||| || ||||||| |
|
|
| T |
19908461 |
tttataatagaatcttattgcgtagtttgatccatgtacctgaccccacttagtgggataaggcttggt |
19908393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 304 - 336
Target Start/End: Original strand, 21519167 - 21519199
Alignment:
| Q |
304 |
gccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
21519167 |
gccgaccccacttagtgggataaagcttggttg |
21519199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 336
Target Start/End: Complemental strand, 38758067 - 38758027
Alignment:
| Q |
296 |
tccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38758067 |
tccatgtagccgaccccacttagtgggataaggcttggttg |
38758027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 8e-25; HSPs: 104)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 46148233 - 46148303
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
46148233 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggtcaaggcttggttg |
46148303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45486926 - 45486856
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
45486926 |
tttatgatagaacattatggcataatttgatccatgtagccggccccacttagtgggataaagcttggttg |
45486856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 48508440 - 48508510
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
48508440 |
tttatgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
48508510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 266 - 333
Target Start/End: Complemental strand, 40116415 - 40116348
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| || |||||| |
|
|
| T |
40116415 |
tttatgatagaacattatggcgtaatttgatccacgtagccgacctcgcttagtgggataaggcttgg |
40116348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 54128584 - 54128654
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| || ||||||||| |
|
|
| T |
54128584 |
tttatgatagaacattatggcataatttgatccatgtaggcgaccccacttagtgggataaggcttggttg |
54128654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 12096780 - 12096712
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12096780 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
12096712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 270 - 333
Target Start/End: Complemental strand, 24778682 - 24778619
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
24778682 |
tgatagaacattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttgg |
24778619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 265 - 336
Target Start/End: Complemental strand, 37083370 - 37083299
Alignment:
| Q |
265 |
ttttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
37083370 |
ttttatgatcgaacattatggcgtaatttggtccttgtagccgaccccacttagtgggataaggcttggttg |
37083299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 333
Target Start/End: Complemental strand, 42510093 - 42510026
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||||||||||| |||| || |||||| |
|
|
| T |
42510093 |
tttatgattgaacattatggcgtaatttgatccatgtagccgaccccacttagagggaaaaggcttgg |
42510026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 265 - 336
Target Start/End: Original strand, 49042141 - 49042212
Alignment:
| Q |
265 |
ttttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||| ||| || || ||||||||| |
|
|
| T |
49042141 |
ttttatgatagaacactatggcgtaatttgatccatgtagccgaccccacttggtgagataaggcttggttg |
49042212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 22281 - 22347
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||| | ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
22281 |
tgatagaacactatggcgtcatttgatctatgtagccgaccccacttagtgggataaagcttggttg |
22347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 5169041 - 5169107
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
5169041 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
5169107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 24541409 - 24541343
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||| ||||||||||||||||||| || ||||| |
|
|
| T |
24541409 |
tttaggatagaacattatggcgtaatttgatccatgtacccgaccccacttagtgggataaggcttg |
24541343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 48734224 - 48734158
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| || ||||| |
|
|
| T |
48734224 |
tttatgatagaacattatggcgtaagttgatccatgtagctgaccccacttagtgggataaggcttg |
48734158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 52927917 - 52927855
Alignment:
| Q |
274 |
agaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52927917 |
agaacattatggcataatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
52927855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 15296117 - 15296182
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||| || |||||||||||||||||||| || ||||||||| |
|
|
| T |
15296117 |
gatagaacattatggtgtaatttgatccatgtggccgaccccacttagtgggataaggcttggttg |
15296182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 36304156 - 36304241
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||| | || ||||| ||| ||||| |
|
|
| T |
36304156 |
tggatcaaaatatggtttatgataggacattatggcgtaatttgatccatgtagccgaccccactcaatgtgacaaggctcggttg |
36304241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 38060919 - 38060976
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38060919 |
tttatgatagaacaccatggcgtaatttgatccatgtagccgaccccacttagtggga |
38060976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 275 - 336
Target Start/End: Original strand, 41529975 - 41530036
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
41529975 |
gaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
41530036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 271 - 336
Target Start/End: Complemental strand, 45374549 - 45374484
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
45374549 |
gatagaacattatggcgtaatttaatccatgtagctgaccccacttagtgggataaggcttggttg |
45374484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 49045025 - 49045110
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||| | ||||||| ||||||||||||| ||||| ||||| ||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
49045025 |
tggatccaaatatagtttatgacagaacattatggccgaatttaatccatgtagccgaccccactcagtgggacaaggcttggttg |
49045110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 7895955 - 7895887
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
7895955 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttg |
7895887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 19676156 - 19676088
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
19676156 |
tatgatagagcattatggcgtgatttgatccatgtagctgaccccacttagtgggataaggcttggttg |
19676088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 32170612 - 32170680
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| ||||||||| | |||||||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
32170612 |
tatgatataacattatgacataatttgatccatgtagccgaccccacttagtgagataaagcttggttg |
32170680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 47555407 - 47555339
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
47555407 |
tatgatagaacactatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
47555339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 52139007 - 52139075
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52139007 |
tatgatagaacactatgacgttatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
52139075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 48532162 - 48532233
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccac-gtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
48532162 |
tttatgatagaacactatggcgtcatttgatccaatgtagccgaccccacttagtgggataaggcttggttg |
48532233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 311382 - 311316
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| ||||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
311382 |
tgatagaacactatggcgtcatttgatacatgtagccgaccccacttagtgggataaggcttggttg |
311316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 2133689 - 2133619
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||| |||||||||||||||||| || ||||||||| |
|
|
| T |
2133689 |
tttatgatagaacactatggcgtgatttgatccatgtactcgaccccacttagtgggataaggcttggttg |
2133619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 30797899 - 30797829
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | ||| ||||||||||||||||| | || ||||||||| |
|
|
| T |
30797899 |
tttatgatagaacattatgacgtaatttgatctatgtaaccgaccccacttagtggaataaggcttggttg |
30797829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 31566234 - 31566168
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||||| || |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31566234 |
tgatagaacactatggtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
31566168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 33825806 - 33825716
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
33825806 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
33825716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 38326052 - 38325962
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
38326052 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
38325962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 38850326 - 38850396
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||||||||||||| ||| ||| ||| |||| |
|
|
| T |
38850326 |
tttatgatagaacactatgacgtaatttgatccatgtagccgaccccacttagtaggataaaacttagttg |
38850396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 40273278 - 40273212
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || | ||||||| |
|
|
| T |
40273278 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggtttggttg |
40273212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 320
Target Start/End: Original strand, 40991636 - 40991690
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40991636 |
tttatgatagaacattatggtgtaatttgatccatgtagctgaccccacttagtg |
40991690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45289168 - 45289098
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| || ||| |||||||||||||||| || ||||||||| |
|
|
| T |
45289168 |
tttatgatagaacattatagcataatttgatccatgtcgccaaccccacttagtgggataaggcttggttg |
45289098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 52156161 - 52156091
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| || ||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
52156161 |
tttatgatagaacactatggcgtcatctgatccatgtagccgaccccacttagtgggataaggctcggttg |
52156091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 53262350 - 53262416
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
53262350 |
tgatagaacactatggcgtcatttgatctatgtagccgaccccacttagtgggataaggcttggttg |
53262416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 55490572 - 55490662
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
55490572 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
55490662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 29601097 - 29601154
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
29601097 |
tttatgatagaacattatgatgtaatttgatccatgtagctgaccccacttagtggga |
29601154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 49503632 - 49503575
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
49503632 |
attatggcgtaatttgatccatgtagccgaccctacttagtgggataaggcttggttg |
49503575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 52882726 - 52882669
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
52882726 |
attatggcgtaatttgatccatgtagccaaccccacttagtgggagaaggcttggttg |
52882669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 388337 - 388269
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||| |||||||||||| | |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
388337 |
tatgatagagcattatgacgtaatttgatcaatgtagccaaccccacttagtgggataaggcttggttg |
388269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 272 - 336
Target Start/End: Original strand, 7278675 - 7278739
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
7278675 |
atagaacattataacgtcatttgatccatgtagccgaccccacttagtgggataaagcttagttg |
7278739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 333
Target Start/End: Original strand, 19758092 - 19758158
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |||||||||||||||||| || |||||| |
|
|
| T |
19758092 |
tttatgatagaacattatggtataatttgatccatgtag-cgaccccacttagtgggataaggcttgg |
19758158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 23534647 - 23534592
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||| ||||| |||| |
|
|
| T |
23534647 |
tttatgatagaacattatggcgtaatttgatccatgtagtcgacctcactttgtgg |
23534592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 253 - 336
Target Start/End: Original strand, 25191569 - 25191652
Alignment:
| Q |
253 |
gatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||| |||||||||| |||||||| |||||||||| ||||| || |||||||||||||| || ||||||||| |
|
|
| T |
25191569 |
gatcaaaatatggtttttgatagaacactatggcgtcatttgatccatgtagctgatcccacttagtgggataatgcttggttg |
25191652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 14415336 - 14415267
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| | ||||||||||||||||||||||| || |||||||| |
|
|
| T |
14415336 |
tttatgatataacattatggcataatttgatc-atgtagccgaccccacttagtgggataagacttggttg |
14415267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 271 - 337
Target Start/End: Original strand, 29919484 - 29919550
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttga |
337 |
Q |
| |
|
||||||| |||||||| |||||||||| | ||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
29919484 |
gatagaatattatggcataatttgatcaatgtaaccgaccctacttagtgggacaaagcttgattga |
29919550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 271 - 337
Target Start/End: Original strand, 29968637 - 29968703
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttga |
337 |
Q |
| |
|
||||||| |||||||| |||||||||| | ||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
29968637 |
gatagaatattatggcataatttgatcaatgtaaccgaccctacttagtgggacaaagcttgattga |
29968703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 31454298 - 31454232
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| ||||||| || |||||||||||||||||||||| || ||||||||| |
|
|
| T |
31454298 |
tgatagaacactatggcgtcatttgattcatttagccgaccccacttagtgggataaggcttggttg |
31454232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 39208813 - 39208883
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||| ||||||| ||||||||| | ||||||||| |
|
|
| T |
39208813 |
tttatgatagaacattatgacgtaatttgatccatgtagaggaccccagttagtgggatatggcttggttg |
39208883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 251 - 333
Target Start/End: Complemental strand, 39782009 - 39781928
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
|||||| |||||| ||||||||||| |||||||||||||||||||| | || |||||||||||| ||||||| || |||||| |
|
|
| T |
39782009 |
tggatccaaatacggtttatgataga-cattatggcgtaatttgatcaatgtggccgaccccactcagtgggataaggcttgg |
39781928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 40106697 - 40106627
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| | |||||||||| | |||| ||||||||||||||||| || ||||||||| |
|
|
| T |
40106697 |
tttatgatagaacattatgacataatttgatcaatgtagtggaccccacttagtgggataaggcttggttg |
40106627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 40122619 - 40122689
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||| | ||| |||||||| ||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
40122619 |
tttatgattgaacattatgacttaacttgatccatgtagccgaccccacttagttggataaaacttggttg |
40122689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 46075278 - 46075368
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| || |||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
46075278 |
ttattctagatacacatggatatatcctcagaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
46075368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 47233669 - 47233603
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| ||||||| || ||||||||||||| ||||||||| || ||||||||| |
|
|
| T |
47233669 |
tgatagaacactatggcgtcatttgattcatgtagccgaccccagttagtgggataaggcttggttg |
47233603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 53519789 - 53519855
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
53519789 |
tgatagaacactatgacgtcatttgatccatgtagccgaccccacttagtgagataaggcttggttg |
53519855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 335
Target Start/End: Original strand, 20208207 - 20208272
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||| ||||||| | |||||||||| ||||||||||||| ||||||||| || |||||||| |
|
|
| T |
20208207 |
tgatagaactttatggcatcatttgatccatgtagccgaccccatttagtgggataacgcttggtt |
20208272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 332
Target Start/End: Complemental strand, 29928366 - 29928305
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||| |||||||| |||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
29928366 |
gatagaatattatggcataatttgatcaatataaccgaccccacttagtgggacaaagcttg |
29928305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 332
Target Start/End: Complemental strand, 29977520 - 29977459
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||| |||||||| |||||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
29977520 |
gatagaatattatggcataatttgatcaatataaccgaccccacttagtgggacaaagcttg |
29977459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 35420479 - 35420543
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||||| ||||||||| || ||||||||| |
|
|
| T |
35420479 |
gatagaacattatggcgtaatttggtccatgtag-cgaccccatttagtgggataaggcttggttg |
35420543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 659732 - 659800
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
659732 |
tatgatagaacattatggcagtgtttgatccatgtagccgaccccacttagtggggtaaggcttggttg |
659800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 46367462 - 46367394
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||| |||||||||| | ||| |||||||||||| |
|
|
| T |
46367462 |
tatgatagaacattatgacgtcgtttgatccatgtagcctaccccacttaattggataaagcttggttg |
46367394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 276 - 336
Target Start/End: Original strand, 49888402 - 49888462
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||| ||| || | ||||||| |
|
|
| T |
49888402 |
aacattatgacgtaatttgatccatgtagccgaccccacttagttggaaaaggtttggttg |
49888462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 272 - 336
Target Start/End: Complemental strand, 50960708 - 50960644
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||| ||||||||||||| ||||| |||||||||||||||| || ||||||||| |
|
|
| T |
50960708 |
atagaccattatggtgtaatttgatccatttagccaaccccacttagtgggataaggcttggttg |
50960644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 51447792 - 51447724
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || ||||||| ||||| ||||||||| || ||||||||| |
|
|
| T |
51447792 |
tatgatagaacactatggcgtcatttgattcatgtagccggccccatttagtgggataaggcttggttg |
51447724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 333
Target Start/End: Original strand, 19737189 - 19737255
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| |||| |||||||||||||||||| || |||||| |
|
|
| T |
19737189 |
tttatgataaaacattatggtataatttgatccatgtag-cgaccccacttagtgggataaggcttgg |
19737255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 317
Target Start/End: Complemental strand, 27796057 - 27796006
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||| || |||||||||| |
|
|
| T |
27796057 |
tttatgatagaacattatggcgtaatttgatctatgtacccaaccccactta |
27796006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 45834662 - 45834607
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
45834662 |
tatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
45834607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 333
Target Start/End: Complemental strand, 54365052 - 54364986
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||||||||| ||| |||||||| || |||||| |
|
|
| T |
54365052 |
tttatgatagaacactatgacgtaatttgatccatgtagccgaccacac-tagtgggataaggcttgg |
54364986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 30332633 - 30332567
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| |||||||||||| | |||| ||||||| |||||||| | ||||||||| |
|
|
| T |
30332633 |
tgatagaacattatggcataatttgatccaggcagcctaccccacctagtgggatacggcttggttg |
30332567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 314
Target Start/End: Original strand, 49841823 - 49841869
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccac |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
49841823 |
tatgatagaacattatggcataatttgatccatgtagctgaccccac |
49841869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 31146906 - 31146974
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||||| ||||||||| ||||||||||||| || ||| ||||| |
|
|
| T |
31146906 |
ttatgataaaacat-atggtgtaatttgatccatgtagccgactccacttagtgggataaggctcggttg |
31146974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 315
Target Start/End: Complemental strand, 34844650 - 34844601
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccact |
315 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| ||||||||||||||| |
|
|
| T |
34844650 |
tttatgatagaacattatggtataatatgatccatgtagccgaccccact |
34844601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 278 - 335
Target Start/End: Complemental strand, 40672432 - 40672375
Alignment:
| Q |
278 |
cattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||| |||||||||||| || |||||||| |
|
|
| T |
40672432 |
cattatggcataatttgatccatgtagctgacctcacttagtgggataaggcttggtt |
40672375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 336
Target Start/End: Original strand, 35481143 - 35481203
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||||||| ||||| || ||||||||| |
|
|
| T |
35481143 |
aacattatgacgtaatttgattcatttagccgaccccacttaatgggataaggcttggttg |
35481203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 322
Target Start/End: Complemental strand, 40116545 - 40116489
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
|||||||||||||||| |||||||||| |||| |||||||| ||| | ||||||||| |
|
|
| T |
40116545 |
tttatgatagaacattgtggcgtaattcgatctacgtagccaacctcgcttagtggg |
40116489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 45493767 - 45493699
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| ||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
45493767 |
tatgatagagcattatggcgccattcaatccatgtagccgaccccacttagtaggataaagcgtggttg |
45493699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 53214938 - 53214878
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||||||||||||||| | ||||||||||| ||||| ||| || ||||||||| |
|
|
| T |
53214938 |
aacattctggcgtaatttgatccatgcagccgaccccatttagtcggataaggcttggttg |
53214878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 2340792 - 2340741
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||| |||||||||||| |
|
|
| T |
2340792 |
tatgatagaacattatggcgttgtttgatccatgaagccaaccccacttagt |
2340741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 301 - 336
Target Start/End: Original strand, 8566673 - 8566708
Alignment:
| Q |
301 |
gtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8566673 |
gtagccgaccccacttagtgggataaagcttggttg |
8566708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 272 - 323
Target Start/End: Complemental strand, 21428065 - 21428014
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||| ||| ||| ||||| |
|
|
| T |
21428065 |
atagaacattatggcgtaatttgatccatgtagtcgactccatttattggga |
21428014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 289 - 336
Target Start/End: Original strand, 34253688 - 34253735
Alignment:
| Q |
289 |
aatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
34253688 |
aatttgatccatgtagccgaccccatttagtgggacagggcttggttg |
34253735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 297
Target Start/End: Complemental strand, 41482214 - 41482183
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatc |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41482214 |
tttatgatagaacattatggcgtaatttgatc |
41482183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 4472464 - 4472394
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||| ||||| |||| |||||||| ||||||||| |||||||| || |||||||||||| |
|
|
| T |
4472464 |
tttataatagaacactatggtgtaacttgatccatgtagccgactacacttagttcgataaagcttggttg |
4472394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 42026611 - 42026565
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccac |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||| || ||||||||||||| |
|
|
| T |
42026611 |
tatgatagaacattatggcgttatttgattcatttagccgaccccac |
42026565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 43694848 - 43694778
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| || | ||| |||||||| | |||| |||||||| ||||||||| |||||| ||||| |
|
|
| T |
43694848 |
tttatgatagaacaatacgacgtcatttgatctatgtagtcgaccccatttagtgggataaagctgggttg |
43694778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 316
Target Start/End: Complemental strand, 48953496 - 48953446
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccactt |
316 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||| ||||||||| |||||| |
|
|
| T |
48953496 |
tttatgatagaacactatgacgtaatttaatccatgtagccgacgccactt |
48953446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 50249582 - 50249652
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||| ||| || ||||||||| |||| |||||||||||||||||| | ||||||||| |
|
|
| T |
50249582 |
tttatgagagaacattgcggcttactttgatccatgtagtcgaccccacttagtgggatacggcttggttg |
50249652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 283 - 323
Target Start/End: Original strand, 1512046 - 1512087
Alignment:
| Q |
283 |
tggcgtaatttgatccacgtagccga-ccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
1512046 |
tggcgtaatttgatccatgtagccgacccccacttagtggga |
1512087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 6780735 - 6780686
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
6780735 |
gatagaacgttatgacgtaatttgatccctgtagccgaccacacttagtg |
6780686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 320
Target Start/End: Complemental strand, 21862813 - 21862764
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
||||||| | ||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
21862813 |
gatagaagaatatggtgtcatttgatccatgtagccgaccccacttagtg |
21862764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 336
Target Start/End: Original strand, 26990442 - 26990487
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||||||||||||||||||||| || || ||||||||| |
|
|
| T |
26990442 |
tttgattcacgtagccgaccccacttagtgagataaggcttggttg |
26990487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 320
Target Start/End: Complemental strand, 33755412 - 33755367
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||| |||||||||||| | |||||| ||||||||||||| |
|
|
| T |
33755412 |
gaacattatgacgtaatttgatcgatgtagccaaccccacttagtg |
33755367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 39512777 - 39512818
Alignment:
| Q |
295 |
atccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
39512777 |
atccatgtagccgaccccacttagtgggataaggcttggttg |
39512818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 39600758 - 39600701
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||| || || ||||||||| |||||| |
|
|
| T |
39600758 |
tttacgatagaacattatggtgtaatttgatccatctaaccaaccccactttgtggga |
39600701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 41971345 - 41971292
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||| || ||||||||||| |
|
|
| T |
41971345 |
tatgatagaacattatgacgttgtttgatccatgtagccaactccacttagtgg |
41971292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 303 - 336
Target Start/End: Complemental strand, 43396122 - 43396089
Alignment:
| Q |
303 |
agccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
43396122 |
agccgaccccacttagtgggataaagcttggttg |
43396089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 317
Target Start/End: Original strand, 54279227 - 54279276
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
|||||||||||| |||||||| |||||||| | |||||||| |||||||| |
|
|
| T |
54279227 |
tatgatagaacactatggcgtcatttgatcaatgtagccgatcccactta |
54279276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 272 - 320
Target Start/End: Original strand, 28245648 - 28245696
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||| |||| ||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
28245648 |
atagaacactatgacgtcatttgatccatgtagccgatcccacttagtg |
28245696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 279 - 323
Target Start/End: Original strand, 34610465 - 34610509
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||| ||||||||||| || |||||||||||||||||||||| |
|
|
| T |
34610465 |
attatgacgtaatttgattcatttagccgaccccacttagtggga |
34610509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 46431754 - 46431686
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||||| ||||| ||||||||| || ||| |||||||||||||||| || ||||||||| |
|
|
| T |
46431754 |
tatgatggaacattgaggcgtcgtttgatccatgtcgccaaccccacttagtgggataaggcttggttg |
46431686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 59; Significance: 8e-25; HSPs: 90)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 9496071 - 9496141
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
9496071 |
tttatgatagaacattatggcgtaatttgatccatgtagccaaccccacttagtgggacaaggcttggttg |
9496141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 9531677 - 9531607
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
9531677 |
tttatgatggaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
9531607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 451723 - 451655
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
451723 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggacaaggcttggttg |
451655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 33504431 - 33504499
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
33504431 |
tatgatagaacattatggcgtaatttgatccatctagccgaccccacttagtgggataaggcttggttg |
33504499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 3720492 - 3720426
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
3720492 |
tttatgatagaacattatggtgtaatttgatccatgtagccgaccccacttagtgggagaaggcttg |
3720426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 12520139 - 12520069
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12520139 |
tttatgataaaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
12520069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 19336970 - 19336900
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| | |||||||| ||||| |||||||||||| |
|
|
| T |
19336970 |
tttatgatagaacattatggcgtaatttgatccatgtagccaatcccacttattgggataaagcttggttg |
19336900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 19863439 - 19863509
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
19863439 |
tttatgatagaacattatggcatgatttgatccatgtagccgtccccacttagtgggataaagcttggttg |
19863509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 19867771 - 19867841
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
19867771 |
tttatgatagaacattatggcatgatttgatccatgtagccgtccccacttagtgggataaagcttggttg |
19867841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 19872672 - 19872742
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
19872672 |
tttatgatagaacattatggcatgatttgatccatgtagccgtccccacttagtgggataaagcttggttg |
19872742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 28508883 - 28508953
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28508883 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
28508953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 30306237 - 30306307
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30306237 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
30306307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 42549914 - 42549844
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||||| || |||||| |||||||||||||||| |||||||||||| |
|
|
| T |
42549914 |
tttatgatagaacatcatggcgtaatttgattcatgtagccaaccccacttagtgggataaagcttggttg |
42549844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 43573207 - 43573137
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
43573207 |
tttatgatcgaacgttatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
43573137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 251 - 336
Target Start/End: Complemental strand, 39709293 - 39709208
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
39709293 |
tggatcaaaatatggtttatgattgaacactatggcgtaatttgatccatgtagccgaccccacttagtgggatatggcttggttg |
39709208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 45077919 - 45078004
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||| | ||||||||||||||| ||||| |||||||||||| ||| |||||||||||||||| || |||||||||||| |
|
|
| T |
45077919 |
tggatcgaaatatagtttatgatagaacataatggcataatttgatccatgtaaccgaccccacttagtgagataaagcttggttg |
45078004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 227396 - 227464
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
227396 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
227464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 3243728 - 3243660
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3243728 |
tatgatagaacactatggcgtcatttgatccaggtagccgaccccacttagtgggataaggcttggttg |
3243660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 3481361 - 3481429
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||| || ||||||||| |
|
|
| T |
3481361 |
tatgatagaacattatggcgtaatttgatccatgtagctgaccccacttagttggaaaaggcttggttg |
3481429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 12475002 - 12474934
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12475002 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
12474934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 251 - 335
Target Start/End: Original strand, 18959101 - 18959185
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||| || |||||||| |
|
|
| T |
18959101 |
tggatcaaaatatggtctatgatagaacattatggcataatttgatccatgtagctgaccccacttagtgggataaggcttggtt |
18959185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 3635396 - 3635330
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3635396 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
3635330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 12734905 - 12734975
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| |||| |||||||||||||||||| || ||||||||| |
|
|
| T |
12734905 |
tttatgatagaacactatggtgtaatttgatccatgtagtcgaccccacttagtgggataaggcttggttg |
12734975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 25834883 - 25834953
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| | |||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
25834883 |
tttatgatagaacactgtggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
25834953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 34931637 - 34931707
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
34931637 |
tttatgatagaacattatggcataatttgatccatatagccgaccgtacttagtgggacaaggcttggttg |
34931707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 38435157 - 38435227
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| | || ||||||||| |
|
|
| T |
38435157 |
tttatgattgaacattatggcgtaatttgatccatgtagccgatcccacttagtggcataaggcttggttg |
38435227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 45543150 - 45543084
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||||||||||||||||||||| || ||||| |
|
|
| T |
45543150 |
tttatgatagaacattatggcgtactttgatctatgtagccgaccccacttagtgggataatgcttg |
45543084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 4807805 - 4807870
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4807805 |
gatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
4807870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 7326235 - 7326167
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
7326235 |
tatgatagaacactatggcgtcatttgatccatgtagccaaccccacttagtgggataaggcttggttg |
7326167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 273 - 336
Target Start/End: Original strand, 17670680 - 17670743
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
17670680 |
tagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
17670743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 38328444 - 38328377
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38328444 |
atgatagaacactatggcttcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
38328377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 6219170 - 6219240
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| ||||||| |||| ||| || ||||||||| |
|
|
| T |
6219170 |
tttatgatagaacattatggtgtaatttgatccatgtagccaaccccacctagttggataaggcttggttg |
6219240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 11992181 - 11992115
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||| ||||||||||||||| | || ||||||||| |
|
|
| T |
11992181 |
tgatagaacattatggcgttatttgatccatgtagctgaccccacttagtggaataaggcttggttg |
11992115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 12506648 - 12506738
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
12506648 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
12506738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 12882118 - 12882052
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||| ||| |||||||||||| || ||||||||| |
|
|
| T |
12882118 |
tgatagaacattttggcgtaatttgatccatgtagcctacctcacttagtgggataaggcttggttg |
12882052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 14679278 - 14679188
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
14679278 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
14679188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 31959726 - 31959796
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||| ||||||||||||| ||| || ||||||||| |
|
|
| T |
31959726 |
tttatgatagaacactatggcataatttgatccatgtagcagaccccacttagtaggataaggcttggttg |
31959796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 35755322 - 35755252
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| || |||||||||||||| | ||||||||| ||||||||||| || ||||||||| |
|
|
| T |
35755322 |
tttatgatagaacattgtgccgtaatttgatccatgcagccgaccctacttagtgggataaggcttggttg |
35755252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 39589234 - 39589324
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
39589234 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
39589324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 323
Target Start/End: Complemental strand, 887138 - 887085
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
887138 |
tgatagaacattatggcgtaatttgatccatgtagctgaccccacttggtggga |
887085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 2610795 - 2610863
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||| |||||||||||||||| || || ||||||||| |
|
|
| T |
2610795 |
tatgatagaacactatggcgttatttgatccatgtaaccgaccccacttagtgagataaggcttggttg |
2610863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 8197616 - 8197548
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| ||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
8197616 |
tatgatagaatattatggcgtcgtttgatccatgtagccgaccctacttagtgggataatgcttggttg |
8197548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 8202376 - 8202308
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| ||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
8202376 |
tatgatagaatattatggcgtcgtttgatccatgtagccgaccctacttagtgggataatgcttggttg |
8202308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 17429257 - 17429325
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| | ||||||||| || |||||||||||||||||||| || || ||||||||| |
|
|
| T |
17429257 |
tatgatagaacattatgacataatttgattcatgtagccgaccccacttagtgagataaggcttggttg |
17429325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 270 - 334
Target Start/End: Original strand, 38430093 - 38430157
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||| || || ||||||| |
|
|
| T |
38430093 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgagataaggcttggt |
38430157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 9556446 - 9556376
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| || |||||||||| || ||||||||| ||||||||||||| | ||||||||| |
|
|
| T |
9556446 |
tttatgatagaacattagggtgtaatttgatacatgtagccgactccacttagtgggatgaggcttggttg |
9556376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 10516826 - 10516756
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| || ||||||||||||||||||||| ||||| || | |||||||||||| || ||||||||| |
|
|
| T |
10516826 |
tttatgataaaatattatggcgtaatttgatccatgtagctgatctcacttagtgggataaggcttggttg |
10516756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 272 - 334
Target Start/End: Original strand, 25384680 - 25384742
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| ||| |||||||||||| || ||||||| |
|
|
| T |
25384680 |
atagaacactatggcgtaatttgatccatgtagccaacctcacttagtgggataaggcttggt |
25384742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 41197300 - 41197234
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||||| ||||| || ||||||||| |
|
|
| T |
41197300 |
tgatagaacattatggcgtcatttgatccatgtagtcgaccccacttgatgggataaggcttggttg |
41197234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 251 - 336
Target Start/End: Complemental strand, 186224 - 186139
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||| | |||| |||||||||| ||| | ||||||||| || || ||||||| |||||||||||| |||||||||||| |
|
|
| T |
186224 |
tggatccaaataaagtttaagatagaacatcatgtcataatttgattcatgtggccgacctcacttagtgggataaagcttggttg |
186139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 13443985 - 13443928
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||| ||||||||||||||||| |||||||| | ||||||||||||| ||||||||| |
|
|
| T |
13443985 |
tttattatagaacattatggcgtcatttgatcgatgtagccgaccccatttagtggga |
13443928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 251 - 336
Target Start/End: Complemental strand, 41763135 - 41763050
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||| |||| |||||||||| ||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
41763135 |
tggatccaaatatgttttttgatagaacacccgggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
41763050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 3866279 - 3866347
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| | | |||||||||| ||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
3866279 |
tatgatagaacactatgacatcatttgatccatgtagccgaccccacttagtaggataaggcttggttg |
3866347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 8180987 - 8181055
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||| | || |||||||||| ||||||||||||||||||||||| || |||| |||| |
|
|
| T |
8180987 |
tatgatagaacactatagtgtcatttgatccatgtagccgaccccacttagtgggataaggcttcgttg |
8181055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 334
Target Start/End: Complemental strand, 21281540 - 21281472
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| | |||| |||||| ||||||||| || ||||||| |
|
|
| T |
21281540 |
tttacgatagaacattatggcttaatttgatccatgcagccaaccccaattagtgggataaggcttggt |
21281472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 314
Target Start/End: Complemental strand, 23915770 - 23915722
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccac |
314 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | |||||||||||| |
|
|
| T |
23915770 |
tttatgatagaacactatggcgtaatttgatccatgcagccgaccccac |
23915722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 36183658 - 36183726
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||| | |||||||||| ||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
36183658 |
tatgatagaacactatggtgccatttgatccatgtagccgaccccacttagtaggataaggcttggttg |
36183726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 38452761 - 38452693
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||| ||||| || ||| |||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38452761 |
tatgataaaacactatggtgtcattcgatccatgtagccgaccccacttagtgggataaggcttggttg |
38452693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 336
Target Start/End: Original strand, 11412922 - 11412985
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| | |||||||| ||| || ||||||||| |
|
|
| T |
11412922 |
tagaacattatggtgtaatttgatccatgtagccgaactcacttagtaggataaggcttggttg |
11412985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 269 - 323
Target Start/End: Original strand, 440924 - 440978
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||| ||| |||||||| |||| |
|
|
| T |
440924 |
atgatacaacattatggcgtaatttgatccatgtagctgactccacttagaggga |
440978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 2515248 - 2515182
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||| |||||| ||||||||||| ||||||| | |||||||||||||||||||||| || ||||| |
|
|
| T |
2515248 |
tttattatagaatattatggcgtactttgatctatctagccgaccccacttagtgggataaggcttg |
2515182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14444874 - 14444944
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||| |||||||||| ||||||||| |||||| ||||||||||||||| || ||||||||| |
|
|
| T |
14444874 |
tttatgattgaatgttatggcgtactttgatccatgtagccatccccacttagtgggataaggcttggttg |
14444944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 276 - 322
Target Start/End: Original strand, 32443851 - 32443897
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
32443851 |
aacattatggcataatttgatccatgtagccgactccacttagtggg |
32443897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 33287626 - 33287696
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| | || |||||||| |||||| || |||||||||||||||| |||||||| |
|
|
| T |
33287626 |
tttatgatagaacattatgacatagtttgatccttgtagccaactccacttagtgggacaagacttggttg |
33287696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 36366841 - 36366911
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||| || |||||| ||||||| | ||||||||||| |
|
|
| T |
36366841 |
tttataatagaacattatggtgtaatttgatccatgtatccaaccccatttagtggtaataagcttggttg |
36366911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 44437794 - 44437728
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| ||| || || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
44437794 |
tgatagaacactatggcgttgtttaattcatgtagccgaccccacttagtgggataaggcttggttg |
44437728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 332
Target Start/End: Complemental strand, 45367698 - 45367636
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| || |||||||||||||||||||| ||| |||| |
|
|
| T |
45367698 |
tgatagaacactatgacgtcatttgatccatgtcgccgaccccacttagtgggataaaacttg |
45367636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 33393316 - 33393384
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||| | || ||||||||| ||| ||||||||||||| ||||| |||||||||||| |
|
|
| T |
33393316 |
ttatgatagaacat-atgtcatagtttgatccatgtaaccgaccccacttactgggataaagcttggttg |
33393384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 335787 - 335719
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||| |||||||||||| |||| | ||||||||||| ||| | |||||||||| |
|
|
| T |
335787 |
tatgatagaacattacggcataatttgatccatatagcaggccccacttagtaggatatagcttggttg |
335719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 267 - 323
Target Start/End: Original strand, 3030885 - 3030940
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||| ||||||||||| |||||| ||||| |||| |||||||||||||||||| |
|
|
| T |
3030885 |
ttatgatacaacattatggcataattttatccatgtag-cgaccccacttagtggga |
3030940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 318
Target Start/End: Complemental strand, 9996703 - 9996651
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttag |
318 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
9996703 |
tttatgattaaacactatggcataatttgatccatgtagccgaccccacttag |
9996651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 19855669 - 19855737
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||| ||| ||||| ||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
19855669 |
tatgatagagcattatggcgccattcaatccatgtagccgaccccacttagtaggataaagcgtggttg |
19855737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 32364996 - 32364928
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||| | ||||| |||| |||||| | ||| || ||||||||| |
|
|
| T |
32364996 |
tatgatagaacattatggtgtaatttgatcaatgtagctgacctcacttaataggaaaaggcttggttg |
32364928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 35643155 - 35643223
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| | | |||| || || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
35643155 |
tatgatagaacactatgacatcatttaatacatgtagccgaccccacttagtgggataaggcttggttg |
35643223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 289 - 336
Target Start/End: Complemental strand, 16521061 - 16521014
Alignment:
| Q |
289 |
aatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
16521061 |
aatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
16521014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 26850439 - 26850510
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacg-tagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||||||||||| || | | ||||| |||||||||||||||| || | ||||||| |
|
|
| T |
26850439 |
tttatgataaaacattatggcgtaatttgttcgatgttagccaaccccacttagtgggaaaaggtttggttg |
26850510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 37470208 - 37470153
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||| | |||||||||||||| |
|
|
| T |
37470208 |
tatgatagaacattatggtgtagtttgatccatgtagctaatcccacttagtggga |
37470153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 289 - 336
Target Start/End: Complemental strand, 45483039 - 45482992
Alignment:
| Q |
289 |
aatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
45483039 |
aatttgatctatgtagccgaccccacttagtgggataaggcttggttg |
45482992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 12141751 - 12141805
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
||||||||||||||||||| | |||||||| | |||||| |||||| |||||||| |
|
|
| T |
12141751 |
tatgatagaacattatggcatgatttgatcgatgtagccaaccccatttagtggg |
12141805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 12489875 - 12489809
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||| | |||||| |||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12489875 |
tgatataacactttggcgtcgtttgattcatgtagccgaccccacttagtgggataaggcttggttg |
12489809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 18424454 - 18424385
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||| ||| ||| ||||||||||||||| || |||||||| |
|
|
| T |
18424454 |
tttatgatagaacactatgacgtcatttgatccatgta-ccgtccccacttagtgggataagacttggttg |
18424385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 296
Target Start/End: Complemental strand, 42149737 - 42149707
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
42149737 |
tttatgatagaacattatggcgtaatttgat |
42149707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 42543444 - 42543510
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
42543444 |
tgatagaacgctatggcgttgtttgattcatgtagccggccccacttagtgggataaggcttggttg |
42543510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 2902028 - 2901967
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagcc-gaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||||||| |||||| ||||||||||||||| | || ||||||||| |
|
|
| T |
2902028 |
aacattatggtgtaatttgatccttgtagcccgaccccacttagtggaaaaaggcttggttg |
2901967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 336
Target Start/End: Complemental strand, 12026064 - 12026019
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
12026064 |
tttgatccatgtagctgaccccacttagtgggataaagtttggttg |
12026019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 270 - 335
Target Start/End: Original strand, 19024387 - 19024452
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||| ||||||||| ||||||| | |||||||||||||| ||||||| || |||||||| |
|
|
| T |
19024387 |
tgatagaactttatggcgtcgtttgatctatatagccgaccccactcagtgggataaggcttggtt |
19024452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 26670973 - 26671030
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
26670973 |
tttatgatagaatataatggtgtaatttgatccatgtagccgacactgcttagtggga |
26671030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 36993741 - 36993809
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| |||||| | || ||||||||||| || ||||||||| |
|
|
| T |
36993741 |
ttatgatatcacattatgacgtaatttgatccatgtagccta-ccaacttagtgggataaggcttggttg |
36993809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 328
Target Start/End: Original strand, 19224988 - 19225048
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaag |
328 |
Q |
| |
|
|||||||||||| |||| || ||||||||| ||||||||||||||||||| ||| |||| |
|
|
| T |
19224988 |
tatgatagaacactatgatgtcgtttgatccatgtagccgaccccacttagtcggaaaaag |
19225048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 253 - 321
Target Start/End: Original strand, 36650634 - 36650702
Alignment:
| Q |
253 |
gatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||| | |||||||||||||| ||| ||||||||||||| ||||| ||| ||| ||||||| |
|
|
| T |
36650634 |
gatcaaaatatagtttatgatagaacactataacgtaatttgatccgtgtagctgactccatttagtgg |
36650702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 2e-22; HSPs: 82)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 332
Target Start/End: Original strand, 490540 - 490606
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
490540 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
490606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 45419440 - 45419510
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
45419440 |
tttatgatagaacattatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
45419510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 271 - 336
Target Start/End: Complemental strand, 1928659 - 1928594
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
1928659 |
gatagaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
1928594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 267 - 336
Target Start/End: Complemental strand, 27556378 - 27556309
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
27556378 |
ttatgatagaacattatggcataatttgatccatgtagccgaccccacttagtgggttaaagcttggttg |
27556309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 269 - 336
Target Start/End: Original strand, 32276893 - 32276960
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||| |||||||||||||| |||||||||||| |
|
|
| T |
32276893 |
atgatagaacattatggcgtaatttgatccatgtagacgaacccacttagtgggataaagcttggttg |
32276960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 29520854 - 29520924
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||| || ||||||||| |
|
|
| T |
29520854 |
tttatgatagaacattatggcgtaatttgatccatgtagcccaccccatttagtgggataatgcttggttg |
29520924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 30689940 - 30690009
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
30689940 |
tttatgatataacattatgacgtaatttgatccatgtagccgaccccacttagtgggataatgcttggtt |
30690009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 267 - 336
Target Start/End: Complemental strand, 35647006 - 35646937
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||| ||||||||| |
|
|
| T |
35647006 |
ttatgatagaacattatggcgtaatttgatccatgcagccgaccccacttagtgtaacaaggcttggttg |
35646937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 11523798 - 11523730
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
11523798 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
11523730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 32931167 - 32931235
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
32931167 |
tatgatagaacattatggcataatttgatccatgtagccgaccccacttagtgggaaaagccttggttg |
32931235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 35362725 - 35362657
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||| |||||||||||||||| || ||||||||| |
|
|
| T |
35362725 |
tatgatagaacattatggcgtaatttgatccatgcagccaaccccacttagtgggaaaaggcttggttg |
35362657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 14742155 - 14742089
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
14742155 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
14742089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 21121351 - 21121420
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||||||||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
21121351 |
tttatgatagaacactatggcgtaatttgat-catgtagccgaccccacttagtgggaaaaggcttggttg |
21121420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 35914678 - 35914624
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
35914678 |
tttatgatagaacattatggcgtaatttgatccatgtagctgaccccacttagtg |
35914624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 44529430 - 44529500
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
44529430 |
tttatgatagaacactatggcatcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
44529500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45041393 - 45041323
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
45041393 |
tttatgatagcgcattatggcgtaatttgatccatgtagctgaccccacttagtgggataaggcttggttg |
45041323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 1313770 - 1313839
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||| || ||||||||| |
|
|
| T |
1313770 |
ttatgatagaacattatggcgtaattttatccatgtagttgaccccacttagtgggataatgcttggttg |
1313839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 35323991 - 35324048
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
35323991 |
attatgacgtaatttgatccacgtagccgaccccacttagtgggataaggcttggttg |
35324048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 41212066 - 41212138
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatcca--cgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
41212066 |
tttatgatagaacattatggcgtaatttgatccatctatagccgaccccacttagtgggaaaatgcttggttg |
41212138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 12491213 - 12491145
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || |||| |||| |
|
|
| T |
12491213 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttagttg |
12491145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 272 - 336
Target Start/End: Original strand, 18741843 - 18741907
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
18741843 |
atagaacattatgacgtaatttgatccaagtagccgaccccacttagtgggataagacttggttg |
18741907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 272 - 336
Target Start/End: Original strand, 18746807 - 18746871
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
18746807 |
atagaacattatgacgtaatttgatccaagtagccgaccccacttagtgggataagacttggttg |
18746871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 25473478 - 25473410
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
25473478 |
tatgatagaacactatagcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
25473410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 36545356 - 36545424
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
36545356 |
tatgatagaacactatgacgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
36545424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 36565316 - 36565248
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
36565316 |
tatgatagaacactatggcgttatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
36565248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 269 - 336
Target Start/End: Original strand, 44699674 - 44699741
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
44699674 |
atgatagaacactatggcgtaatttgatccctgtagcagaccccacttagtgggaaaaggcttggttg |
44699741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14903766 - 14903836
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||||| ||||||||||||||| ||| |||||||| |
|
|
| T |
14903766 |
tttatgataggacattatggcgtaatttgatccatgtagcttaccccacttagtggggaaaaacttggttg |
14903836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 23927326 - 23927236
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
23927326 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
23927236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 44047609 - 44047539
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
44047609 |
tttatgatagaacaccatggcgtcatttgatccatgtagctgaccccacttagtgggataaggcttggttg |
44047539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 44199825 - 44199915
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
44199825 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
44199915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 8255610 - 8255538
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagcc--gaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| |||||| ||| ||||||||||||| |||||||||||| |
|
|
| T |
8255610 |
tttatgatagaccaatatggcgtaatttgatccatgtagccgagacaccacttagtgggataaagcttggttg |
8255538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 29700481 - 29700534
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||| ||||||||| |
|
|
| T |
29700481 |
tttatgatagaacattatggtgtaatttgatccatgtagccgactccacttagt |
29700534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 266 - 334
Target Start/End: Original strand, 2216491 - 2216559
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||| ||||||||||||||| |||| || || ||||||| |
|
|
| T |
2216491 |
tttatgatagaacattatagtgtaatttgatccatgtagccgaccccactcagtgagataaggcttggt |
2216559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 266 - 310
Target Start/End: Complemental strand, 43904742 - 43904698
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgacc |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43904742 |
tttatgatagaacattatggcgtaatttgatccatgtagccgacc |
43904698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 328
Target Start/End: Complemental strand, 16035804 - 16035742
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaag |
328 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| || ||||| ||||||||||||||||| |||| |
|
|
| T |
16035804 |
tttatggtagaacattatgacgtaatttgattcatgtagctgaccccacttagtgggataaag |
16035742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 30198343 - 30198273
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||| | || |||||||||||||||||||| || ||||||||| |
|
|
| T |
30198343 |
tttatgatagaatattatggtgtagtttgatctatgttgccgaccccacttagtgggataaggcttggttg |
30198273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 36143546 - 36143616
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||| |||||||||||||| |||| ||| || ||||||||| |
|
|
| T |
36143546 |
tttatgatagaacattatgacgtcatctgatccatgtagccgaccccacctagtcggaaaaggcttggttg |
36143616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 39967576 - 39967506
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||| |||||||| |||||||| || || || ||||||||| |
|
|
| T |
39967576 |
tttatgttagaacattatggcgtagtttgatccatgtagccgatcccacttattgtgataatgcttggttg |
39967506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 42469800 - 42469734
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||| ||||||||||| ||||| || ||||||||| |
|
|
| T |
42469800 |
tgatagaacactatggcgtcatttgatccatgtagctgaccccacttattgggataaggcttggttg |
42469734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 270 - 323
Target Start/End: Original strand, 2796762 - 2796815
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||| |||||||||||||||||| |
|
|
| T |
2796762 |
tgatagaacagtatggcgtaatttgattcatgtagacgaccccacttagtggga |
2796815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 42584564 - 42584620
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
42584564 |
tttatgatagaacattatgacgtaatttgat-cttgtagccgaccccacttagtggga |
42584620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 271 - 335
Target Start/End: Complemental strand, 35320472 - 35320408
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||||||| |||||| || | ||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
35320472 |
gatagaacattatggcttaatttaattaatgtagctgaccccacttagtgggataaagcttggtt |
35320408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14459100 - 14459171
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccga-ccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||| |||||||| |||||||| |||||| || |||||||| |
|
|
| T |
14459100 |
tttatgatggaacattatggtgtaatttgatccatgtagccgacccccactttgtgggataagccttggttg |
14459171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 323
Target Start/End: Original strand, 16715480 - 16715535
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
16715480 |
tatgatagaacattatggcggtgtttgatccacgtagccgaccctgcttagtggga |
16715535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 21425251 - 21425306
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||| ||||| ||||| ||||||||| |
|
|
| T |
21425251 |
tttatgatagaccattatggcataatttgatccatgtagcagaccctacttagtgg |
21425306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 30559898 - 30559973
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatcc-----acgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| | ||||||||||||| ||||||||| || ||||||||| |
|
|
| T |
30559898 |
tttatgatagaacattatgacgtaatttgatccatgtaatgtagccgaccccagttagtgggataaggcttggttg |
30559973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 3473775 - 3473845
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||| ||||||||| ||||| ||||| |||||||||||||||||||||| || |||| |||| |
|
|
| T |
3473775 |
tttatgattgaatattatggcgaaatttaatccatttagccgaccccacttagtgggataaggctttgttg |
3473845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 8932912 - 8932978
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||| |||||||| |||||||||| ||||| |||||||||||||| | |||||||||||| |
|
|
| T |
8932912 |
tgataaaacactatggcgtcatttgatccatgtagctgaccccacttagtgaaataaagcttggttg |
8932978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 273 - 335
Target Start/End: Original strand, 39388998 - 39389060
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||| |||||||||| ||||||||| || ||| |||||||||||||||| ||||||||||| |
|
|
| T |
39388998 |
tagaagattatggcgtcgtttgatccatgtggccaaccccacttagtgggataaagcttggtt |
39389060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 41031489 - 41031427
Alignment:
| Q |
274 |
agaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
41031489 |
agaacattatgagataatttgatccatatagccgaccccacttagtgggataaggcttggttg |
41031427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 41031595 - 41031533
Alignment:
| Q |
274 |
agaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| || ||||||||| |
|
|
| T |
41031595 |
agaacattatgagataatttgatccatatagccgaccccacttagtgggataaggcttggttg |
41031533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 270 - 319
Target Start/End: Complemental strand, 2518471 - 2518422
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||| ||||||||||||| |
|
|
| T |
2518471 |
tgatagaacattatggcataatttgatccttgtagctgaccccacttagt |
2518422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 31716025 - 31716097
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagc--cgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||| | | ||||||||||||| || ||||||||| |
|
|
| T |
31716025 |
tttaagatagaacattatggcgtaatttgatccatgtagcgtcaccaccacttagtgggataaggcttggttg |
31716097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 270 - 323
Target Start/End: Complemental strand, 42854077 - 42854024
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||| |||| |||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
42854077 |
tgatataacactatggcgtcatttgatccatgtagccgaccccatttagtggga |
42854024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 279 - 336
Target Start/End: Complemental strand, 45512508 - 45512451
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||||||||||||||| | ||||||||| |
|
|
| T |
45512508 |
attatggcataatttgatccatgtagcctaccccacttagtgggatgaggcttggttg |
45512451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 272 - 336
Target Start/End: Complemental strand, 15215483 - 15215419
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||| ||| || ||||||| ||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
15215483 |
atagaacactatgacgtcatatgatccatgtagccgaccccacttagtaggataaggcttggttg |
15215419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 320
Target Start/End: Original strand, 23492241 - 23492293
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||| ||||| || |||| ||||| |||||||||||||||||||| |
|
|
| T |
23492241 |
tatgatagaacactatggtgtcatttaatccatgtagccgaccccacttagtg |
23492293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 311
Target Start/End: Original strand, 24558693 - 24558733
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccc |
311 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
24558693 |
gatagaacattatgacgtaatttgatccatgtagccgaccc |
24558733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 270 - 334
Target Start/End: Complemental strand, 30812889 - 30812825
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||||| ||||| || |||||| || ||||||||||||||||||||||| || ||||||| |
|
|
| T |
30812889 |
tgatagaacactatggtgtcgtttgattcatgtagccgaccccacttagtgggaaaaggcttggt |
30812825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 39651091 - 39651035
Alignment:
| Q |
280 |
ttatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||||||| || ||||||||| |
|
|
| T |
39651091 |
ttatggtgtaatttgatccatatacccgaccccacttagtgggataaggcttggttg |
39651035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 279 - 334
Target Start/End: Complemental strand, 14742902 - 14742847
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||| |||| ||||||||| |||||| |||||||||||||||| || ||||||| |
|
|
| T |
14742902 |
attatgacgtagtttgatccatgtagccaaccccacttagtgggataaggcttggt |
14742847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 309
Target Start/End: Complemental strand, 17491731 - 17491688
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgac |
309 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
17491731 |
tttatgatagaacattatggcgtatgttgatccatgtagccgac |
17491688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 309
Target Start/End: Original strand, 34692605 - 34692648
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgac |
309 |
Q |
| |
|
|||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
34692605 |
tttatgatagaatattatgtcgtaatttgatcaacgtagccgac |
34692648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 317
Target Start/End: Original strand, 36069807 - 36069858
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||| | |||||||| |
|
|
| T |
36069807 |
tttatgatagaacattacggcgtaatttgatccatatagccaaacccactta |
36069858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 320
Target Start/End: Original strand, 79236 - 79286
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
||||||||||| ||||||| ||||||||| ||| |||||||||||||||| |
|
|
| T |
79236 |
tgatagaacataatggcgtcgtttgatccatgtacccgaccccacttagtg |
79286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 10824262 - 10824196
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||| | |||| ||| || ||||||||| |
|
|
| T |
10824262 |
tgatagaacattatgaagtaagttgatccatgtagccgaccccgcctagtcggaaaaggcttggttg |
10824196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 286 - 336
Target Start/End: Original strand, 37077974 - 37078024
Alignment:
| Q |
286 |
cgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
37077974 |
cgtaatttgatccatgcagccgaccccacttaatgggataaaacttggttg |
37078024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 39702163 - 39702229
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| | |||||||| | |||||||||| || ||||||||| ||| |||||||| |
|
|
| T |
39702163 |
tgatagaacattatggtatcatttgatctatgtagccgaccacatttagtgggataaaacttggttg |
39702229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 40813533 - 40813599
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||| | | |||||||||| |||||| |||||||||||||||| ||| ||| |||| |
|
|
| T |
40813533 |
tgatagaacactatgacatcatttgatccatgtagccaaccccacttagtgggataaaacttcgttg |
40813599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 5127379 - 5127322
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||| ||| | ||||||||| |||||| |
|
|
| T |
5127379 |
tttatgatagaacattacggcgtaatttgacccatgtaactaaccccacttggtggga |
5127322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 336
Target Start/End: Complemental strand, 10668569 - 10668504
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||| || |||||||| | |||||||||| |||||||||||| || ||||||||| |
|
|
| T |
10668569 |
gatagaacactatgaggtcatttgatcgatgtagccgacctcacttagtgggataaggcttggttg |
10668504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 336
Target Start/End: Original strand, 26055651 - 26055696
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| || ||||||||| |
|
|
| T |
26055651 |
tttgatccatgtagccgatcccacttagtgggataaggcttggttg |
26055696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 251 - 332
Target Start/End: Complemental strand, 30783134 - 30783053
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||| |||||| ||||| ||| ||||||||| ||| ||||||||| ||||||||||||| |||||||| ||| |||| |
|
|
| T |
30783134 |
tggatcgaaatacggtttataataaaacattatgaggtagtttgatccatgtagccgaccccatctagtgggataaaacttg |
30783053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 336
Target Start/End: Complemental strand, 35643660 - 35643615
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
35643660 |
tttgatccatgtagcctaccccacttagtgggataatgcttggttg |
35643615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 291 - 336
Target Start/End: Complemental strand, 36395000 - 36394955
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || |||| |||| |
|
|
| T |
36395000 |
tttgatccatgtagccgaccccacttagtgggataaggcttcgttg |
36394955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 317
Target Start/End: Complemental strand, 38391968 - 38391919
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
38391968 |
tatgatagaatattatggcgtaatttcatccatgtggccgatcccactta |
38391919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 336
Target Start/End: Complemental strand, 43350787 - 43350738
Alignment:
| Q |
287 |
gtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||||| || ||||||| || ||||||||| |
|
|
| T |
43350787 |
gtaatttgatccaagtagccgaccccgctaagtgggataaggcttggttg |
43350738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 336
Target Start/End: Original strand, 1064955 - 1064995
Alignment:
| Q |
296 |
tccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
1064955 |
tccatgtagccgaccccacttagtgggataaggcttggttg |
1064995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 287 - 323
Target Start/End: Original strand, 1335552 - 1335588
Alignment:
| Q |
287 |
gtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
1335552 |
gtaatttgattcatgtagccgaccccacttagtggga |
1335588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 32569785 - 32569717
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| | ||||||||||||| ||||||||| || |||||||| |
|
|
| T |
32569785 |
tatgatagaacactatgacgtcatttgatttatgtagccgaccccatttagtgggataagacttggttg |
32569717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 288 - 336
Target Start/End: Complemental strand, 40982951 - 40982903
Alignment:
| Q |
288 |
taatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| || |||||||||| ||||||||| || ||||||||| |
|
|
| T |
40982951 |
taatttgatccatgttgccgaccccatttagtgggaaaaggcttggttg |
40982903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 270 - 306
Target Start/End: Complemental strand, 41035125 - 41035089
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagcc |
306 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| |
|
|
| T |
41035125 |
tgatagaacattatggcgtaatttgattcatgtagcc |
41035089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 106)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 40980005 - 40979935
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
40980005 |
tttatgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
40979935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 2885799 - 2885729
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
2885799 |
tttatgatagaacactatggtgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
2885729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 12841352 - 12841282
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12841352 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
12841282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 27648985 - 27649055
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
27648985 |
tttatgatagaacactgtggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
27649055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 28208405 - 28208335
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28208405 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
28208335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 28628010 - 28627940
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||| || |||| |||| |
|
|
| T |
28628010 |
tttatgatagaacattatggcgtaatttgatccatgtagccgactccacttagtgggataaggcttagttg |
28627940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 276 - 338
Target Start/End: Original strand, 28708596 - 28708658
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttgat |
338 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
28708596 |
aacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttgat |
28708658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 31682679 - 31682609
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31682679 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
31682609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 268 - 338
Target Start/End: Complemental strand, 35906276 - 35906206
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttgat |
338 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
35906276 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttgat |
35906206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 43281883 - 43281949
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43281883 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggacaaggcttggttg |
43281949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 251 - 336
Target Start/End: Complemental strand, 36101869 - 36101784
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||| |||| ||||||||||||||||| || ||||||||| |
|
|
| T |
36101869 |
tggatcaaaatatggtttatgatagaacattatgacgtaatttgatccatgtagttgaccccacttagtgggataaggcttggttg |
36101784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 6375075 - 6375143
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
6375075 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
6375143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 11594167 - 11594235
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
11594167 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
11594235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 251 - 323
Target Start/End: Complemental strand, 30814217 - 30814145
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30814217 |
tggatcgaaatatgttttatgatagaacattatcacgtaatttgatccatgtagccgaccccacttagtggga |
30814145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 39906447 - 39906379
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
39906447 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
39906379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 42187645 - 42187716
Alignment:
| Q |
266 |
tttatgatagaacatt-atggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| || |||| |||| |
|
|
| T |
42187645 |
tttatgatagaacatttatggcgtaatttgatccatgtagccgaccccacttagtgggataaggctttgttg |
42187716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 1011251 - 1011321
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
1011251 |
tttaggatagaacattatggtgtaatttgatctatgtagccgaccccacttagtgggataaggcttggttg |
1011321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 3716588 - 3716498
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||||| || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
3716588 |
ttattctagatacacatggatatatcctctgaaactcaaatctcatacactttctacatttcagaattttaaaactatgattgaattgcag |
3716498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 9210781 - 9210711
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||||| || |||| |||| |
|
|
| T |
9210781 |
tttatgatacaacattatggcgtaatttgatccatgtagctgaccccacttagtgggataaggcttcgttg |
9210711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 28355355 - 28355441
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtag-ccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |||||||||||||||| | ||||||||||||||||| || ||||||||| |
|
|
| T |
28355355 |
tggatcaaaatatggtttatgataaaacattatggcggaatttgatccacgtagtctgaccccacttagtgggataaggcttggttg |
28355441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45836559 - 45836489
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
45836559 |
tttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
45836489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 4604752 - 4604809
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
4604752 |
tttatgatagaacattatggcgtactttgatccatgtagccaaccccacttagtggga |
4604809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 267 - 336
Target Start/End: Complemental strand, 31681096 - 31681027
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| | |||| |||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31681096 |
ttatgatagaatactatgacgtaatttgatccatgtagccgaccccacttagtgggaaaaggcttggttg |
31681027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 267 - 336
Target Start/End: Complemental strand, 38135289 - 38135220
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
38135289 |
ttatgatagaatattatggcgtaatttgatccatctagctgaccccacttggtgggacaaggcttggttg |
38135220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 47652757 - 47652822
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
47652757 |
gatagaacattatggcgtaacttgatccctgtagccgaccccacttagtgggataaggcttggttg |
47652822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 272 - 333
Target Start/End: Original strand, 47852298 - 47852359
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||| |||| || |||||| |
|
|
| T |
47852298 |
atagaacattatggcgtaatttgatccatgtagccgaccccacttagggggataaggcttgg |
47852359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 334
Target Start/End: Original strand, 15682379 - 15682447
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||| ||||||||||||| || |||||||||| |
|
|
| T |
15682379 |
tttatgatagaacactatggcgtactttgatccatgtagccaaccccacttagtgagataaagcttggt |
15682447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 266 - 326
Target Start/End: Complemental strand, 24376100 - 24376040
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaa |
326 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||||| | ||||||||||||| |
|
|
| T |
24376100 |
tttatgatggaacattatggcgtaatttgatccatgtagccgacctcgcttagtgggacaa |
24376040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 36652199 - 36652267
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
36652199 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
36652267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 37618152 - 37618220
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||| || |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
37618152 |
tatgatagaacactatggtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
37618220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 265 - 336
Target Start/End: Complemental strand, 27893641 - 27893570
Alignment:
| Q |
265 |
ttttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||||||| |||||||| || || ||||||||| |
|
|
| T |
27893641 |
ttttatgatagaacattatggcataatttgattcatgtagccgaccctacttagtgcgataaggcttggttg |
27893570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 34035228 - 34035161
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
34035228 |
atgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggattaggcttggttg |
34035161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14057683 - 14057753
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |||||||||||| ||| || |||| |||| |
|
|
| T |
14057683 |
tttatgatagaacattatggggtaatttgatccatgtagccaaccccacttagtaggataaggcttagttg |
14057753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14367711 - 14367781
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||||| |||||||||||| ||| || |||| |||| |
|
|
| T |
14367711 |
tttatgatagaacattatggggtaatttgatccatgtagccaaccccacttagtaggataaggcttagttg |
14367781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 25891093 - 25891163
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||||||||||||||||||| || || ||||||||| |
|
|
| T |
25891093 |
tttataatagaacattatggtgtaatttgatccatgtagccgaccccacttagtacgataaggcttggttg |
25891163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 29650593 - 29650659
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| || ||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
29650593 |
tgatagaacactaaggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
29650659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 31869175 - 31869109
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| | |||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31869175 |
tgatagaacactctggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
31869109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 34029749 - 34029683
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||||| ||||||| || ||||||||| |
|
|
| T |
34029749 |
tgatagaacattatggcgtaatttgatccatgtagccaaccccaccaagtgggataaggcttggttg |
34029683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 267 - 321
Target Start/End: Complemental strand, 40391899 - 40391845
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
40391899 |
ttatgatagaacattatggcgtaatttgatccatctaaccgaccccacttagtgg |
40391845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 43491513 - 43491583
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
43491513 |
tttatgatagaacactatgatgtaatttcatccatgtagccgaccccacttagtgggataaggcttggttg |
43491583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 48511793 - 48511703
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
48511793 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
48511703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 48726235 - 48726145
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
48726235 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
48726145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 6263477 - 6263534
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
6263477 |
attatggcataatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
6263534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 267 - 336
Target Start/End: Complemental strand, 40149089 - 40149020
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||| ||||||||||||| || ||||||||| |
|
|
| T |
40149089 |
ttatgatagaacattatggcgcaatttgatctatgtagccgaatccacttagtgggataaggcttggttg |
40149020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 335
Target Start/End: Complemental strand, 45054380 - 45054311
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| |||||||||||||||| || ||| || |||||||| |
|
|
| T |
45054380 |
tttatgatagaatattatggcgtaatttggtccatgtagccgaccccacttggttggataatgcttggtt |
45054311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 45601666 - 45601751
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| ||||||||||||| ||||| || | |||||||||||| || ||||||||| |
|
|
| T |
45601666 |
tggatcaaaatatgatttatgatagaacactatggtgtaatttgatccatgtagctgaactcacttagtgggataaggcttggttg |
45601751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 21078124 - 21078192
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| || ||||||||| || ||||||||| |
|
|
| T |
21078124 |
tatgatagaacattatggcgtcatttgatccatgtagccgacttcatttagtgggataaggcttggttg |
21078192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 266 - 338
Target Start/End: Original strand, 33103131 - 33103203
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttgat |
338 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| ||||||||||||||||||| ||| || |||||| |||| |
|
|
| T |
33103131 |
tttatgatagaacaccatagcgtaatttgatccatgtagccgaccccacttagtaggataaggcttggctgat |
33103203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 34869627 - 34869695
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||| | ||||||||| || ||||||||| |
|
|
| T |
34869627 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccctaattagtgggataaggcttggttg |
34869695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 44855241 - 44855181
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||||||||||||| |||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
44855241 |
aacactatggcgtaatttggtccatgtagccgaccccacttagtgggataaggcttggttg |
44855181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 33732039 - 33732107
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||| || ||||||||| |
|
|
| T |
33732039 |
tttatgatagaacattatggc--aatttgatccatgtagccggtcccacttagtgggataaggcttggttg |
33732107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 34341472 - 34341417
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||| | | ||||||||||||| ||||||| |
|
|
| T |
34341472 |
tttatgatagaacattatggcgtaatttgaccaatgtagccgaccccatttagtgg |
34341417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 281 - 336
Target Start/End: Original strand, 40630654 - 40630709
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
40630654 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggaaaaggcttggttg |
40630709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 323
Target Start/End: Original strand, 49029483 - 49029538
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||| |||||||||||||||| |
|
|
| T |
49029483 |
tatgatagaacactatggcgtcatttgatccatgtagccaaccccacttagtggga |
49029538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 332
Target Start/End: Original strand, 7273305 - 7273371
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||| | || |||| |||||||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
7273305 |
tttatgatatagcactatgacgtaatttgatccatgtagccgaccccacttagtgggataaggcttg |
7273371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 24177703 - 24177634
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||| |||||| |||||||||||| ||| |||||||||||| |
|
|
| T |
24177703 |
tttatgatagaacactatggcgtcatt-gatccatgtagccaaccccacttagtaggataaagcttggttg |
24177634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 32631773 - 32631839
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| |||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
32631773 |
tgatagaacgctatggcgtcatttgatctatgtagccgaccccacttagtgggataaggcttggttg |
32631839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 34926599 - 34926542
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||| | |||||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
34926599 |
tttatgatagaacttaatggcgtaatttgatccatgtagccgatcccacttagcggga |
34926542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 42969903 - 42969960
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42969903 |
tttatgattgaacattatcgtataatttgatccatgtagccgaccccacttagtggga |
42969960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 48515376 - 48515433
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||| || || ||||||| ||| ||||||||||| |
|
|
| T |
48515376 |
tttatgatagaacattatggcgtaattttattcatgtagccgccccaacttagtggga |
48515433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 48515480 - 48515537
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||| ||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48515480 |
tttatgatagtacactatgacgtaatttgatccgtgtagccgaccccacttagtggga |
48515537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 251 - 315
Target Start/End: Original strand, 1569206 - 1569270
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccact |
315 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||| | |||| |||||||||| |
|
|
| T |
1569206 |
tggatcaaaatatggtttatgatagaacattacggcgtaatttgatcgatgtagtcgaccccact |
1569270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 334
Target Start/End: Complemental strand, 2882813 - 2882745
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||| |||| ||||||||| || || ||||||| |
|
|
| T |
2882813 |
tttatgatagaacattatggcgtaatttgatctatttagctgacctcacttagtgagaaaaggcttggt |
2882745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 280 - 336
Target Start/End: Original strand, 5418293 - 5418349
Alignment:
| Q |
280 |
ttatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||| ||||||||| || ||||||||| |
|
|
| T |
5418293 |
ttatggcgtaatttgatccatgtagtcgaccccatttagtgggataaggcttggttg |
5418349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 332
Target Start/End: Original strand, 22349827 - 22349891
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||| | |||||||| |||||||||| |||| |||||||||||||||||| || ||||| |
|
|
| T |
22349827 |
tatgatagaatactatggcgtcatttgatccatgtagtcgaccccacttagtgggataaggcttg |
22349891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 24777168 - 24777236
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| ||||||| || |||||||| || ||||||||||| |||||||||||| |
|
|
| T |
24777168 |
tatgatagaacactatgacgtcatttgattcatgtagccgatcctacttagtgggataaagcttggttg |
24777236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 306
Target Start/End: Complemental strand, 36239873 - 36239833
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagcc |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36239873 |
tttatgatagaacattatggcgtaatttgatccatgtagcc |
36239833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 38900164 - 38900231
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||| |||||||| |||||||||| |||||||| |||||||||||||| || ||||||||| |
|
|
| T |
38900164 |
tatgattgaacactatggcgtcatttgatccatgtagccga-cccacttagtgggataaggcttggttg |
38900231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 254 - 306
Target Start/End: Complemental strand, 44401216 - 44401164
Alignment:
| Q |
254 |
atcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagcc |
306 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
44401216 |
atcaaaatatgttttatgatagaacattatgacgtaatttgatccatgtagcc |
44401164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 46355931 - 46355863
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| | | |||||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
46355931 |
tatgatagaacactatgccatcatttgatccatgtagccgaccccacttagtgagataaggcttggttg |
46355863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 273 - 340
Target Start/End: Complemental strand, 27021795 - 27021728
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttgatat |
340 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||||||||||||||||| | |||||||||||| |
|
|
| T |
27021795 |
tagaacattatggcacaatttgatccatgttgccgaccccacttagtgggataggacttggttgatat |
27021728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 26741971 - 26741917
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||| || | ||||||||||| |
|
|
| T |
26741971 |
tttatgatagaacattatggcgtaatttgatcaatgtaaccaatcccacttagtg |
26741917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 290 - 336
Target Start/End: Original strand, 31005434 - 31005480
Alignment:
| Q |
290 |
atttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31005434 |
atttgatccatgtagccgaccccacttagtgggataaggcttggttg |
31005480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 34745956 - 34746022
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
34745956 |
tgatagaacgctatggcgttgtttgattcatgtagccgaccccacttagtgggataaggcttggttg |
34746022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 38607201 - 38607267
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||| |||||||||||| || ||||||||| |
|
|
| T |
38607201 |
tgatagaacactatggcgtcgtttgatccatgtagccgactccacttagtgggttaaggcttggttg |
38607267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 42107074 - 42107163
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||| ||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
42107074 |
ttattctagatacacat-gatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
42107163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 48919317 - 48919387
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| | || |||||||| |||||||||| |||| |||||||||||| ||||| || ||||||||| |
|
|
| T |
48919317 |
tttatgataaaccactatggcgtcatttgatccatgtagtcgaccccacttaatgggataaggcttggttg |
48919387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 270 - 315
Target Start/End: Original strand, 22174209 - 22174254
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccact |
315 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
22174209 |
tgatagaacattatggcgttgtttgatccatgtagccgaccccact |
22174254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 29312207 - 29312264
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||| || ||||||||| |
|
|
| T |
29312207 |
attatggcgtaatttgatccatgaagccgacccagcttagtgggataaggcttggttg |
29312264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 33281097 - 33281161
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||| ||||||||||||| || ||||||||| |
|
|
| T |
33281097 |
gatagaacattatggtgtaatttgatccatgtagccg-gaccacttagtgggataaggcttggttg |
33281161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 275 - 336
Target Start/End: Complemental strand, 47700123 - 47700063
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||| ||||||| |||||| || ||||||||| |
|
|
| T |
47700123 |
gaaccttatggcgtaatttgatccatgtagccga-cccacttggtgggaaaaggcttggttg |
47700063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 319
Target Start/End: Complemental strand, 47796229 - 47796176
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| | |||||| ||| |||||| |
|
|
| T |
47796229 |
tttatgatagaatattatggcgtaatttgatccatgcagccgatcccgcttagt |
47796176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 29318858 - 29318802
Alignment:
| Q |
280 |
ttatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||| |||||||||| || ||||||||| |
|
|
| T |
29318858 |
ttatagcgtaatttgatccatgtagccgacccagcttagtgggataaggcttggttg |
29318802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 336
Target Start/End: Original strand, 33073144 - 33073204
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||| ||| |||||||||| |||||||| |||||||||||||| || ||||||||| |
|
|
| T |
33073144 |
aacaatatgacgtcatttgatccatgtagccgatcccacttagtgggataaggcttggttg |
33073204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 320
Target Start/End: Complemental strand, 40139023 - 40138971
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||| |||||| ||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
40139023 |
tatgatagaatattatgacgtcatttgatccatgtagcagaccccacttagtg |
40138971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 28542021 - 28541950
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccga-ccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| ||||| || |||||||| |||||||| ||||||||||| ||| || ||||||||| |
|
|
| T |
28542021 |
tttatgatagaacatcatggcatagtttgatccgtgtagccgacccccacttagttggataaggcttggttg |
28541950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Original strand, 41483694 - 41483749
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||| |||||| |||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
41483694 |
tatggtagaactttatggtgtcatatgatccatgtagccgaccccacttagtggga |
41483749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 309
Target Start/End: Original strand, 44951360 - 44951403
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgac |
309 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
44951360 |
tttatgatagaacactatgacgtaatttgatccatgtagccgac |
44951403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 291 - 338
Target Start/End: Complemental strand, 47155224 - 47155177
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttggttgat |
338 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
47155224 |
tttgattcatgtagccgaccccacttagtgggataaagcttgattgat |
47155177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 20158748 - 20158678
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||| ||||| ||||| ||||||||||| || ||||||||| |
|
|
| T |
20158748 |
tttaagatagaacactatcaagtaatttgatccatgtagctgaccctacttagtgggataaggcttggttg |
20158678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 308
Target Start/End: Complemental strand, 26332950 - 26332908
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccga |
308 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||| |||||||| |
|
|
| T |
26332950 |
tttatgatagaatattatgacgtaatttgatccatgtagccga |
26332908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 291 - 333
Target Start/End: Original strand, 26847836 - 26847878
Alignment:
| Q |
291 |
tttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||| |
|
|
| T |
26847836 |
tttgatccacgtagccgacccgacttagtgggataaggcttgg |
26847878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 33871477 - 33871547
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||| || |||| ||||||||| || |||||||| |
|
|
| T |
33871477 |
tttatgatagaacattatggcgtaatttcatccatgtaattgagcccagttagtgggataagacttggttg |
33871547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 38103690 - 38103622
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| ||||||||||||| ||||||||| || |||||||| |
|
|
| T |
38103690 |
tttatgata-aacattatggtgtaatttgatcct-gtagccgaccccagttagtgggataagacttggttg |
38103622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 6682558 - 6682627
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||||||||| | |||||| || ||||||||||||||||||||||| || |||||||| |
|
|
| T |
6682558 |
tttatgatagaacattattttggtgtttgattcatgtagccgaccccacttagtgggataaggcttggtt |
6682627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 285 - 322
Target Start/End: Complemental strand, 32789995 - 32789958
Alignment:
| Q |
285 |
gcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
32789995 |
gcgtaatttgatccatgtagctgaccccacttagtggg |
32789958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 336
Target Start/End: Complemental strand, 32879260 - 32879199
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||| |||||| ||| || ||||||||| |
|
|
| T |
32879260 |
gaacattagggcgtaatttgatccttgtagccgaccctgcttagttggataaggcttggttg |
32879199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 271 - 323
Target Start/End: Original strand, 17759483 - 17759535
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||| ||||| || |||||| || ||||||||||||||||||||||| |
|
|
| T |
17759483 |
gatagaacactatggtgttgtttgattcatgtagccgaccccacttagtggga |
17759535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 288 - 336
Target Start/End: Complemental strand, 20525107 - 20525059
Alignment:
| Q |
288 |
taatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||| || ||| ||||| |
|
|
| T |
20525107 |
taatttgatccatgtagccgaccccacttagcgggataaggctcggttg |
20525059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 316
Target Start/End: Complemental strand, 23087180 - 23087128
Alignment:
| Q |
264 |
attttatgatagaacattatggcgtaatttgatccacgtagccgaccccactt |
316 |
Q |
| |
|
|||||||||||||||| |||| |||| |||| |||| |||| ||||||||||| |
|
|
| T |
23087180 |
attttatgatagaacaatatgacgtattttggtccatgtagtcgaccccactt |
23087128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 332
Target Start/End: Complemental strand, 36245331 - 36245267
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| ||| ||||| |||| ||| || ||||| |
|
|
| T |
36245331 |
tatgatagaacattatgacgtcgtttgatccacgtagtcgatcccacatagttggataaggcttg |
36245267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 266 - 318
Target Start/End: Original strand, 37976440 - 37976492
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttag |
318 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| |||||| ||||| ||||| |
|
|
| T |
37976440 |
tttatgatagaacattatggctaaattagatccatgtagccaaccccgcttag |
37976492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 39812145 - 39812213
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| || ||||||||| |||| | ||||||||||||||| || ||||||||| |
|
|
| T |
39812145 |
tatgatagaacattatgatgtcgtttgatccatgtagttggccccacttagtgggataaggcttggttg |
39812213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 40169862 - 40169929
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||| ||||||||||||| |||| |||||||||||| |
|
|
| T |
40169862 |
tatgatagaacattacagcgtaagttgatccgtgtaaccgaccccacttaacggga-aaagcttggttg |
40169929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 265 - 317
Target Start/End: Original strand, 40415211 - 40415263
Alignment:
| Q |
265 |
ttttatgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
||||||||| |||| ||| || |||||||||||| ||||||||||||||||| |
|
|
| T |
40415211 |
ttttatgattgaaccctatagcttaatttgatccatgtagccgaccccactta |
40415263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 251 - 323
Target Start/End: Original strand, 43282021 - 43282092
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| ||||||| | ||||| |||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
43282021 |
tggatcaaaatatggtttatgacaaaacat-atggcgtaatttgatctatctagccgacctcacttagtggga |
43282092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 2e-22; HSPs: 49)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 12890780 - 12890850
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12890780 |
tttatgatagaacactatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
12890850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 31818736 - 31818806
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
31818736 |
tttatgatagaacattatgtcgtaatttgatccatgtagccgaccccacttagcgggaaaaagcttggttg |
31818806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 34582 - 34512
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| || |||||||| |
|
|
| T |
34582 |
tttatgatagaacattatggcgtaatttgatccatgtagctgaccccacttagtgggataagacttggttg |
34512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 30031461 - 30031531
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||| |||||||||||| || ||||||||| |
|
|
| T |
30031461 |
tttatgatagaacactatggcgtaatttgatccatgtagccgacctcacttagtgggataaggcttggttg |
30031531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 5096024 - 5096109
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| | |||||||| |||||||||||||| || | ||||||| |
|
|
| T |
5096024 |
tggatcaaaatatggtttatgatagaacattatggcgtaatttgatctatgtagccgatcccacttagtgggataaggtttggttg |
5096109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 8364761 - 8364818
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
8364761 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccgcttagtggga |
8364818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 31819038 - 31819106
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31819038 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataatgcttggttg |
31819106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 335
Target Start/End: Original strand, 5983841 - 5983905
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||||| ||||||| || |||||||| |
|
|
| T |
5983841 |
gatagaacatgatagcgtaatttgatccacgtagccgaccccactcagtgggataaggcttggtt |
5983905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 28085583 - 28085651
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||| || |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28085583 |
tatgatagaacactatggtgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
28085651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 34934905 - 34934837
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
34934905 |
tatgatagaacactatggcctcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
34934837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 1008124 - 1008059
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| | |||||||||||||||| || ||||||||| |
|
|
| T |
1008124 |
tgatagaacattatggcgtaatttgatccaggtag-caaccccacttagtgggaaaaggcttggttg |
1008059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 9706979 - 9707045
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
9706979 |
tgatagaacactatggcatcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
9707045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 29653702 - 29653792
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
29653702 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
29653792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 257 - 335
Target Start/End: Original strand, 32068616 - 32068694
Alignment:
| Q |
257 |
aaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||| ||||| ||| ||||||||||||||||||||| || |||||||| |||||||||||||| |||| |||||| |
|
|
| T |
32068616 |
aaaatacgatttataatataacattatggcgtaatttgatacatgtagccgatcccacttagtgggataaagtttggtt |
32068694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 579636 - 579693
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
579636 |
attatggcgtaatttgatctatgtagccgatcccacttagtgggataaagcttggttg |
579693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 7337272 - 7337200
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccactt--agtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| |||||||||||||||| || |||| |||||||||||| |
|
|
| T |
7337272 |
tttatgatagaatattatggcgtaatttggtccatgtagccgaccccacttagagggggataaagcttggttg |
7337200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 32080674 - 32080743
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||| ||| |||||||||||||| |||| |||||| |
|
|
| T |
32080674 |
tttatgatataacattatggcgtaatttgatacatgtagtcgatcccacttagtgggaaaaagtttggtt |
32080743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 5258215 - 5258155
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
5258215 |
aacactatggcgtcatttgatccacgtagccgaccccacttagtgggataagtcttggttg |
5258155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 272 - 336
Target Start/End: Complemental strand, 12133973 - 12133909
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| |||| ||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
12133973 |
atagaacattatggcataatctgatccatgtagccgaccccacttagtgagaaaaggcttggttg |
12133909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 34143840 - 34143772
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||| |||||||||||| ||||| || ||||||||| |
|
|
| T |
34143840 |
tatgatagaacactatggcgtcatttgatccatgtagtcgaccccacttattgggataaggcttggttg |
34143772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 34156456 - 34156388
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||| |||||||||||| ||||| || ||||||||| |
|
|
| T |
34156456 |
tatgatagaacactatggcgtcatttgatccatgtagtcgaccccacttattgggataaggcttggttg |
34156388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 272 - 323
Target Start/End: Complemental strand, 3206530 - 3206479
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3206530 |
atagaacactatggcgtcatttgatccatgtagccgaccccacttagtggga |
3206479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 4245945 - 4245879
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||| | | ||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4245945 |
tgatagaacattatgacatcgtttgatccaagtagccgaccccacttagtgggataaggcttggttg |
4245879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 18130891 - 18130821
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| |||||||||||||| || ||||| || |||| |||| |
|
|
| T |
18130891 |
tttattatagaacattatggtgtaatttgatccatgtagccgaccccacctaatgggataaggcttagttg |
18130821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 268 - 322
Target Start/End: Original strand, 32756128 - 32756182
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||| ||||||||||||| |
|
|
| T |
32756128 |
tatgatagaacactatggcgtcatttgatccatgtagccgatcccacttagtggg |
32756182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 7513067 - 7513010
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
7513067 |
tttatgatagaacattatgacgtaatttgatctatgtagttgaccccacttagtggga |
7513010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 272 - 336
Target Start/End: Complemental strand, 12119714 - 12119649
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccga-ccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| ||| |||||||||| |||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
12119714 |
atagaacattatgacgtcatttgatccatgtagccgacccccacttagtgggataaggcttggttg |
12119649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 32097942 - 32098011
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||| ||||||||||||||| ||||| || |||||||| ||||||||||||| |||| |||||| |
|
|
| T |
32097942 |
tttatgatataacattatggcgtaaattgatacatgtagccgattccacttagtgggataaagtttggtt |
32098011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 21089604 - 21089672
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||| | ||||||||||||||| || ||||||||| |
|
|
| T |
21089604 |
tatgatagaacattatggcattgtttgatccatgtagctgcccccacttagtgggataaggcttggttg |
21089672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 272 - 336
Target Start/End: Original strand, 30642980 - 30643044
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||||||||||| | |||||||||||||||||| ||| || ||||||||| |
|
|
| T |
30642980 |
atagaacattatggagtaatttgatctatgtagccgaccccacttagcgggttaaggcttggttg |
30643044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 23888555 - 23888485
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||||| |||||||| || ||||| || |||| |||| |
|
|
| T |
23888555 |
tttattatagaacattatggtgtaatttgatccatgtagcagaccccacctaatgggataaggcttagttg |
23888485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 30789147 - 30789081
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||||||| || ||||||||||| || ||||||||| |
|
|
| T |
30789147 |
tgatagaacactatgacgtcatttgatccatgtagccgatcctacttagtgggataaggcttggttg |
30789081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 251 - 332
Target Start/End: Original strand, 5897647 - 5897728
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||| | |||| ||||| |||||| |||||||||||||| ||||| || |||||||||||||| || ||||| |
|
|
| T |
5897647 |
tggatcaaaatatggtatatggtagaatattatgacgtaatttgatccatgtagcggatcccacttagtgggataaggcttg |
5897728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 7492599 - 7492664
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||| ||||| ||| ||||||||||||||||||||||| || | ||||||| |
|
|
| T |
7492599 |
gatagaacattatagcgttatttgtaccaagtagccgaccccacttagtgggataaggattggttg |
7492664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 1615298 - 1615230
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||| || ||||||||| || |||||||| |
|
|
| T |
1615298 |
tatgatagaacactatgacgtcatttgatccatgtagccgacctcatttagtgggataagacttggttg |
1615230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 304
Target Start/End: Original strand, 1911587 - 1911623
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtag |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1911587 |
tatgatagaacattatggcgtaatttgatccatgtag |
1911623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 322
Target Start/End: Original strand, 2079486 - 2079542
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
||||||||||| |||||| ||||||||| ||||| ||||||||| | |||||||||| |
|
|
| T |
2079486 |
tttatgatagagcattatagcgtaatttaatccatgtagccgactcgacttagtggg |
2079542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 288 - 336
Target Start/End: Original strand, 33730192 - 33730240
Alignment:
| Q |
288 |
taatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
33730192 |
taatttcatccatgtagccgaccccacttagtgggataaggcttggttg |
33730240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 267 - 310
Target Start/End: Complemental strand, 3210584 - 3210541
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgacc |
310 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
3210584 |
ttatgatagaacattatggtgtaatttgatccatgtagctgacc |
3210541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 9593785 - 9593717
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||| |||| |||||||||| | || ||||||||| |
|
|
| T |
9593785 |
tttatgatagaacattatgg--taatttgatccatatagctgaccacacttagtggcataaggcttggttg |
9593717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 608370 - 608436
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| | |||| ||| |||||||||| ||||||||||| ||||||||||| || |||||||| |
|
|
| T |
608370 |
tgatagaatactatgacgtcatttgatccatgtagccgaccctacttagtgggataagacttggttg |
608436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 655471 - 655401
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||| ||| | ||||||||||| |||| |||| |||||||||||| |||| ||||||| |
|
|
| T |
655471 |
tttatgacagaacattgtggtgcaatttgatccatgtaggtgacctcacttagtgggataaagtttggttg |
655401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 299
Target Start/End: Original strand, 7634577 - 7634610
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatcca |
299 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
7634577 |
tttatgatagaacattatagcgtaatttgatcca |
7634610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 28891482 - 28891539
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||| ||||||| || || ||| ||||||| |||||||||| |
|
|
| T |
28891482 |
tttatgatagaacattatggtgtaatttaatacatgtaaccgacccttcttagtggga |
28891539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 251 - 323
Target Start/End: Complemental strand, 43144 - 43072
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| | ||||||||||| ||||||| ||||||| ||||| ||| || || |||||||||||| |
|
|
| T |
43144 |
tggatcaaaatatagtttatgatagagtattatggtgtaattttatccatgtatccagcctcacttagtggga |
43072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 332
Target Start/End: Original strand, 586057 - 586121
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||||||||| ||| ||||||| || | |||||||| |||||| ||||| ||| |||| |
|
|
| T |
586057 |
tatgatagaacattatgacgtcatttgattcatggagccgacctcacttaatgggataaaccttg |
586121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 6293467 - 6293399
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||| |||| || | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
6293467 |
tatgatagagcattatggcaacgtttggtcaatgtagccgaccccacttagtgggataaggcttggttg |
6293399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 30679603 - 30679671
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| ||| |||||||| | |||||||| |||||||| ||||| || |||||||| |
|
|
| T |
30679603 |
tatgatagaacattataacgtcatttgatctatgtagccgatcccacttaatgggataagacttggttg |
30679671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 32945455 - 32945523
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||| |||||||| | | || ||||||||| |
|
|
| T |
32945455 |
tatgatagaacattatggtgtcgtttgatccatgtagccgacatcacttagttgaataaggcttggttg |
32945523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 54; Significance: 7e-22; HSPs: 85)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 267 - 336
Target Start/End: Original strand, 38132542 - 38132611
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||||||||||| || ||||||||| |
|
|
| T |
38132542 |
ttatgatagaacattatggcgtaatttgatccatgtggccgaccccacttagtgggataaggcttggttg |
38132611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 5558346 - 5558416
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
5558346 |
tttatgatagaacactatggcataatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
5558416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 28985292 - 28985358
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| || |||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
28985292 |
tgatagaacattatagcttaatttgatccatgtagccgaccccacttagtgggacaaggcttggttg |
28985358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 38685172 - 38685242
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
38685172 |
tttatgatagaacaatatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
38685242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 418111 - 418054
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
418111 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccacttggtggga |
418054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 267 - 335
Target Start/End: Complemental strand, 2915572 - 2915504
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
2915572 |
ttatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggtt |
2915504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 332
Target Start/End: Original strand, 20456980 - 20457044
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
20456980 |
tatgatagaacattatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttg |
20457044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 29816589 - 29816657
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
29816589 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
29816657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 30213782 - 30213850
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30213782 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
30213850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 42576217 - 42576285
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
42576217 |
tatgatagaacataatggcgtaatttgatccatgtagccgacccgacttagtgggataaggcttggttg |
42576285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 11675735 - 11675805
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| ||||||||||||||||||| ||| || ||||||||| |
|
|
| T |
11675735 |
tttatgatagaacattatggcgtagtttaatccatgtagccgaccccacttagttggataaggcttggttg |
11675805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14667976 - 14668046
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||| || |||||||| |
|
|
| T |
14667976 |
tttatgatagaacattatggtgtaatttgatccatgtaaccgaccccacttagtgggataagacttggttg |
14668046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 18855812 - 18855882
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| || |||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
18855812 |
tttatgatagaacattatagcataatttgatccatgtagccgaccccacttagtgggataagacttggttg |
18855882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 43561966 - 43562056
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatacttcc-acctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | |||||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
43561966 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacacttcctacatttcagaattttaaaaccatgattgaattgcag |
43562056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 275 - 336
Target Start/End: Original strand, 27386554 - 27386615
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| || || |||||| |
|
|
| T |
27386554 |
gaacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggcatggttg |
27386615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 4496591 - 4496659
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
4496591 |
tatgatagaacactatggcatcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
4496659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 10639509 - 10639577
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||| |||||| || ||||||||| |
|
|
| T |
10639509 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccactttgtgggataaggcttggttg |
10639577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 12492459 - 12492391
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
12492459 |
tatgatagaacactatggcgtcatttgatgcatgtagccgaccccacttagtgggataaggcttggttg |
12492391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 28976934 - 28976866
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28976934 |
tatgatagaacactatggcgtcatttgattcatgtagccgaccccacttagtgggataaggcttggttg |
28976866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 271 - 323
Target Start/End: Complemental strand, 32442197 - 32442145
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
32442197 |
gatagaacattatggcgtaatttgatccatgtagccgactccacttagtggga |
32442145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 3302053 - 3302119
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| || ||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
3302053 |
tgatagaacactacggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
3302119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 332
Target Start/End: Original strand, 5860039 - 5860105
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | ||||||||||| ||||||||||| || ||||| |
|
|
| T |
5860039 |
tttatgatagaccattatggcgtaatttgatctatgtagccgaccctacttagtgggataaggcttg |
5860105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 332
Target Start/End: Complemental strand, 13561459 - 13561397
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
13561459 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttg |
13561397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 36664453 - 36664543
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
36664453 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
36664543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 36677324 - 36677234
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
36677324 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
36677234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 270 - 323
Target Start/End: Original strand, 1275473 - 1275526
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
1275473 |
tgatagaacattatgacgtcatttgatccatgtagccgaccccacttagtggga |
1275526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 9235252 - 9235308
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||| |
|
|
| T |
9235252 |
tttatgatagaacattatggcataatttgatccatgtagccga-cccacttagtggga |
9235308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 272 - 336
Target Start/End: Complemental strand, 408565 - 408501
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| | |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
408565 |
atagaatactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
408501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 266 - 334
Target Start/End: Original strand, 6859586 - 6859654
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| || || ||||||||||||||||| || ||||||| |
|
|
| T |
6859586 |
tttatgatagaacattatggcataattttatccatgttgctgaccccacttagtgggataaggcttggt |
6859654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 7359328 - 7359268
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||||||||||||||| |||||||| |
|
|
| T |
7359328 |
aacattatgacgtaatttgatccatgtagctgaccccacttagtgggacaagacttggttg |
7359268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 11069237 - 11069169
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||| |||||||| | ||||||||| |
|
|
| T |
11069237 |
tatgatagaacattatggcgtaatttgatccatatagctgaccccacatagtgggatatggcttggttg |
11069169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 267 - 323
Target Start/End: Original strand, 41894279 - 41894335
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
41894279 |
ttatgatacaacattatggtgtaatttgatccatgtagccaaccccacttagtggga |
41894335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 271 - 323
Target Start/End: Original strand, 42272687 - 42272739
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42272687 |
gatagaacattatggcgtcatttgatccatgtagctgaccccacttagtggga |
42272739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 335
Target Start/End: Complemental strand, 1287654 - 1287587
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||| ||| |||||||| | |||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
1287654 |
tatgatagtacactatggcgtcagttgatccatgtagccgaccccacttagtgggataaggcttggtt |
1287587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 7640584 - 7640529
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
7640584 |
tttatgatagaacactacggcgtaatttgatccatgtagccgatcccacttagtgg |
7640529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14665919 - 14665987
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| | ||||||||||||||| | ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
14665919 |
tttatgatagaac--tctggcgtaatttgatctatgtagccgaccccacttagtgggataaggcttggttg |
14665987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 265 - 336
Target Start/End: Original strand, 28411880 - 28411951
Alignment:
| Q |
265 |
ttttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||||||||| |||||||| |||||| || ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28411880 |
ttttctgatagaacactatggcgttgtttgattcatgtagccgaccccacttagtgggataaggcttggttg |
28411951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 269 - 320
Target Start/End: Complemental strand, 41108803 - 41108752
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41108803 |
atgatagtacattatggcgtaatttgatccatgtagctgaccccacttagtg |
41108752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 27800037 - 27800103
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
27800037 |
tgatagaacattatggtataatttgatacatgtagccaaccccacttagtgggataaggcttggttg |
27800103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 29922489 - 29922559
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||| ||| ||||| |||||| || |||||||| |
|
|
| T |
29922489 |
tttacgatagaacattatggcgtaatttgatccatgtagccaacctcacttggtgggataagccttggttg |
29922559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 38684689 - 38684755
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| ||||||| || |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
38684689 |
tgatagaacattatggcgttatttgattcatgtagttgaccccacttagtggaataaagcttggttg |
38684755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 43475444 - 43475514
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| |||||| |||||| |||||||||||||||||||| || ||||||| ||||| || ||||||||| |
|
|
| T |
43475444 |
tttatggtagaacgttatggtgtaatttgatccacgtagccaactccacttaatgggataaggcttggttg |
43475514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 43557910 - 43557840
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| | ||| |||||| | ||||||||||||||||||||||| || || |||||| |
|
|
| T |
43557910 |
tttatgatagaacattatgacttaagttgatctatgtagccgaccccacttagtgggataaggcctggttg |
43557840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 319
Target Start/End: Original strand, 6788272 - 6788325
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || |||||||||| |||||||| |
|
|
| T |
6788272 |
tttatgatagaacattatagcgtaatttgattcatgtagccgacctcacttagt |
6788325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 7678668 - 7678752
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| |||||| ||||| ||| ||||||||| ||| ||||||||| ||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
7678668 |
tggatcgaaatacggtttataata-aacattatgaggtagtttgatccatgtagccgaccccacttagtgggataaaacttggttg |
7678752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 12576935 - 12576867
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| || |||| || || ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
12576935 |
tatgatagaccattatggtgtcattttatacatgtagccgaccccaattagtgggataaagcttggttg |
12576867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 38830527 - 38830594
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| |||||||| |||||| ||||| ||||||||||||||||| || | ||||||| |
|
|
| T |
38830527 |
tatgatagaacattatagcgtaatt-gatccatgtagctgaccccacttagtgggaaaaggtttggttg |
38830594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 253 - 336
Target Start/End: Original strand, 2090605 - 2090688
Alignment:
| Q |
253 |
gatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||| | |||||||| |||||||||||||||||||||||| ||| ||||||||| | ||||||| || |||| |||| |
|
|
| T |
2090605 |
gatccaaatatagtttatgatccaacattatggcgtaatttgatccatgtacccgaccccattgagtgggataaggctttgttg |
2090688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 16913960 - 16913889
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccga-ccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||| |||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
16913960 |
tttacgatagaacaccatggcgtcatttgatccatgtagccgacccccacttagtgggataaggcttggttg |
16913889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 26884766 - 26884711
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||||||| || | || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
26884766 |
tttatgatagaacactacgacgcaatttgatccatgtagccgaccccacttagtgg |
26884711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 272 - 323
Target Start/End: Complemental strand, 30639787 - 30639736
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
30639787 |
atagaacattgtggtgtaatttgatccatgtagccgaccccatttagtggga |
30639736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 280 - 323
Target Start/End: Complemental strand, 39322142 - 39322099
Alignment:
| Q |
280 |
ttatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39322142 |
ttatggcgtaatttgatccatgtagccgatcccacttagtggga |
39322099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 41200421 - 41200366
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||| ||||||| | |||||||||| |||||| |||||||||||||||| |
|
|
| T |
41200421 |
tatgatagaacgttatggcatcatttgatccatgtagcctaccccacttagtggga |
41200366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 3442944 - 3442878
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||| || ||||||||||||||||||||| | || ||||||||| |
|
|
| T |
3442944 |
tgatagaacactatggcgtcgtttgattcatgtagccgaccccacttagtggcataaggcttggttg |
3442878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 332
Target Start/End: Complemental strand, 15252821 - 15252755
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||||||||||| ||| ||| || || ||||||||||||||||||||||| || ||||| |
|
|
| T |
15252821 |
tttatgatagaacattatgatgtagtttaattcatgtagccgaccccacttagtgggataaggcttg |
15252755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 334
Target Start/End: Complemental strand, 15588465 - 15588399
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
||||| ||||||||||||||| ||||||| | ||||||||||| ||||||||||| || ||||||| |
|
|
| T |
15588465 |
tatgacagaacattatggcgtcgtttgatctatgtagccgaccctacttagtgggataaggcttggt |
15588399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 28276443 - 28276513
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| | ||||| ||||||||||||| |||||| || |||||||| |||| || ||||||||| |
|
|
| T |
28276443 |
tttatgatagaaaactatggtgtaatttgatccatgtagccaactccacttagcgggataaggcttggttg |
28276513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 269 - 334
Target Start/End: Original strand, 79721 - 79786
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||| ||||| | ||||||||||||||| || ||||||| |
|
|
| T |
79721 |
atgatagaccattatggcgtgatttcatccatgtagctggccccacttagtgggaaaaggcttggt |
79786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 683778 - 683721
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| |||||| ||||||||||| |||| |
|
|
| T |
683778 |
tttatgatagaacattatgttgtagtttgatccatgtagccaaccccacttagcggga |
683721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 334
Target Start/End: Original strand, 6889198 - 6889267
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccactt-agtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||| || | || || ||||||| |||||||||| |
|
|
| T |
6889198 |
tttatgatagaacattatggcgtaatttaatccatgtagctgaactcatttaagtgggataaagcttggt |
6889267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 9400716 - 9400773
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||| || | |||||||| |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
9400716 |
tttatgatataatactatggcgtcatttgatccaggtagccgaccccatttagtggga |
9400773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 12534417 - 12534474
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
12534417 |
tttataatagaacattatggcgtaatttgatccatttagttgaccccagttagtggga |
12534474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 30588652 - 30588709
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||| ||||||||||||| ||| || ||||||| ||||||||| ||||||||||||| |
|
|
| T |
30588652 |
tttataatagaacattatgacgtgatatgatccatgtagccgactccacttagtggga |
30588709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 299
Target Start/End: Original strand, 39668908 - 39668941
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatcca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39668908 |
tttatgatagaacattatggcgtaatttgatcca |
39668941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 41833734 - 41833677
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||| ||||| |||||| |||||||||| |
|
|
| T |
41833734 |
tttatgatagaacattttggtgtaatttaatccatgtagctgaccccgcttagtggga |
41833677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 275 - 332
Target Start/End: Complemental strand, 43423563 - 43423506
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||| ||||||||| || ||||| |
|
|
| T |
43423563 |
gaacattatggcgtaatttgatccatgtagccaaccccttttagtgggataaggcttg |
43423506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 332
Target Start/End: Complemental strand, 2075548 - 2075484
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||| | |||||||| ||||||| || |||||| |||||||||||||||| || ||||| |
|
|
| T |
2075548 |
tatgatagaatactatggcgtcatttgattcatgtagccaaccccacttagtgggataaggcttg |
2075484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 277 - 321
Target Start/End: Original strand, 5987732 - 5987776
Alignment:
| Q |
277 |
acattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
5987732 |
acattatgacgtaatttgatcaatgtagccgaccccacttagtgg |
5987776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 28186857 - 28186789
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | ||||||||| ||| | ||||| || ||||||||| |
|
|
| T |
28186857 |
tatgatagaacattatggcgtcgtttgatccatgcagccgaccctactcaatgggataaggcttggttg |
28186789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 288 - 336
Target Start/End: Original strand, 36551373 - 36551421
Alignment:
| Q |
288 |
taatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
36551373 |
taatttgatccatgtagccgaccccacttagtgagataaggcttggttg |
36551421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 218126 - 218059
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||| ||||||||||| ||| |||||| |||||||||||||| |||||||| || |||||||| |
|
|
| T |
218126 |
atgaaagagcattatggcgtcattagatccatgtagccgaccccacctagtgggataagacttggttg |
218059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 321
Target Start/End: Complemental strand, 1104784 - 1104730
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | | || |||||||||||||||| |
|
|
| T |
1104784 |
tttatgatagaacattatggcgtaatttaatcaatg-agtcgaccccacttagtgg |
1104730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 274 - 336
Target Start/End: Complemental strand, 8082033 - 8081970
Alignment:
| Q |
274 |
agaacattatggcgtaatttgatccacgtagccga-ccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| | | |||||||||| |||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
8082033 |
agaacattatgacatgatttgatccatgtagccgacccccacttagtgggataaggcttggttg |
8081970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 332
Target Start/End: Original strand, 9234102 - 9234157
Alignment:
| Q |
277 |
acattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||| | |||||||||||| ||| ||||||||||||||||||| || ||||| |
|
|
| T |
9234102 |
acattatgacataatttgatccatgtaaccgaccccacttagtgggataaggcttg |
9234157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 276 - 331
Target Start/End: Complemental strand, 14330235 - 14330180
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagctt |
331 |
Q |
| |
|
|||||||| | |||||||||| || |||||||||||||| |||||||| ||||||| |
|
|
| T |
14330235 |
aacattattgtgtaatttgattcatgtagccgaccccacatagtgggataaagctt |
14330180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 270 - 317
Target Start/End: Original strand, 14911381 - 14911428
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
|||||||| | |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
14911381 |
tgatagaatactatggcgtcatttgatccatgtagccgaccccactta |
14911428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 16347455 - 16347387
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| | ||||| |||||||||| ||||||||||| ||||||||||| || |||||||| |
|
|
| T |
16347455 |
tttatgatagaacact--ggcgtcatttgatccatgtagccgaccctacttagtgggataagacttggttg |
16347387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Original strand, 27998648 - 27998703
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||| |||||| ||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
27998648 |
tatgatagaatattatgacgtcgtttgatccatgtaaccgaccccacttagtggga |
27998703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 336
Target Start/End: Original strand, 32366186 - 32366253
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| ||| |||||||||| || ||| |||||| |||||||| || ||||||||| |
|
|
| T |
32366186 |
atgatagaacattatgacgtcatttgatccatgtggccaaccccatgtagtgggataaggcttggttg |
32366253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 20367098 - 20367168
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| | ||||||||| |||||||||||||| ||||| ||||||||| || ||| || ||||||||| |
|
|
| T |
20367098 |
tttatgacataacattatgacgtaatttgatccatatagccaaccccacttggtaggataaggcttggttg |
20367168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 304
Target Start/End: Complemental strand, 42504324 - 42504286
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtag |
304 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
42504324 |
tttatgatagaacattatgacgtaatttgatcaacgtag |
42504286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 2713146 - 2713211
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||| | |||||| || |||||||| |||||||||||||| || ||||||||| |
|
|
| T |
2713146 |
gatagaacactatggcatcgtttgattcatgtagccgagcccacttagtgggataaggcttggttg |
2713211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 266 - 335
Target Start/End: Complemental strand, 21193729 - 21193660
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
||||||||||| ||||||| | ||||||||| || ||| |||||||||| |||||| | || |||||||| |
|
|
| T |
21193729 |
tttatgatagatcattatgacataatttgattcatgtatccgaccccacgtagtggaataaggcttggtt |
21193660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 268 - 317
Target Start/End: Original strand, 24178717 - 24178766
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccactta |
317 |
Q |
| |
|
|||||||||||| |||||| | |||||||| | ||||||||||||||||| |
|
|
| T |
24178717 |
tatgatagaacactatggcatcatttgatctatgtagccgaccccactta |
24178766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 273 - 321
Target Start/End: Original strand, 3448831 - 3448879
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||| ||||||||||| |
|
|
| T |
3448831 |
tagaacattatggcgtaatttgattcatgtagtggactccacttagtgg |
3448879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 7e-22; HSPs: 113)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 266 - 323
Target Start/End: Original strand, 35690476 - 35690533
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35690476 |
tttatgatagaacattatggcgtaatttgatccatgtagccgaccccacttagtggga |
35690533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 29399009 - 29399079
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
29399009 |
tttatgatagaacattatggcgtaatttgattcatgtagctgaccccacttagtgggaaaaggcttggttg |
29399079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45209282 - 45209212
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
45209282 |
tttatgatagaatattatggcgtagtttgatccatgtagccgaccccacttagtgggataaggcttggttg |
45209212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 55007951 - 55008021
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
55007951 |
tttatgatagatcattatgacgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
55008021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 253 - 338
Target Start/End: Complemental strand, 34233114 - 34233029
Alignment:
| Q |
253 |
gatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttgat |
338 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||||||||||||| ||||||||| ||||| |||||||||| ||||||||||| |
|
|
| T |
34233114 |
gatcaaaataaggtttatgatagaacattgtagcgtaatttgatccatgtagccgacgccactcagtgggacaatgcttggttgat |
34233029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 31959889 - 31959821
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31959889 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
31959821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 52569590 - 52569522
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
52569590 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
52569522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 36255596 - 36255529
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||||||||||||||||| || ||||||||| |
|
|
| T |
36255596 |
atgatagaacattatggtgtaatttgatccatgtggccgaccccacttagtgggaaaaggcttggttg |
36255529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 26024927 - 26024857
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||| |||||||||| |||||||||||| || ||||||||| |
|
|
| T |
26024927 |
tttatgatagaacattatggtgtaattttatccatgtagccgacctcacttagtgggataaggcttggttg |
26024857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 26037582 - 26037512
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||| || | ||||||| |
|
|
| T |
26037582 |
tttatgatagaacactatggcgtaattggatccatgtagccgaccccacttagtgggataaggtttggttg |
26037512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 27450253 - 27450187
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
27450253 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
27450187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 39100613 - 39100543
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||||||||| | ||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
39100613 |
tttatcatagaacattatggcgtaatataatccatgtagccgaccccacttagtgggataaggcttggttg |
39100543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 51421935 - 51422005
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| | | |||||||||||| |||||||||||| |
|
|
| T |
51421935 |
tttatgatagaacattatgacgtaatttgatccatgtagccaatctcacttagtgggataaagcttggttg |
51422005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 251 - 336
Target Start/End: Original strand, 32479228 - 32479313
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||| |||||||||| ||||||||||||||||||||| | || ||||||||| |
|
|
| T |
32479228 |
tggatcaaaatatggtttttgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtggaaaaaggcttggttg |
32479313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 436436 - 436504
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
436436 |
tatgatagaacactatggcatcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
436504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 1777092 - 1777024
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
1777092 |
tatgatagaacagtatggcgtcatttgatccatgtagccgaccccacttaatgggataaggcttggttg |
1777024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 15661939 - 15661879
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| || | ||||||| |
|
|
| T |
15661939 |
aacattatggcgtaatttgatccatgtagccgaccccacttagtgggataaggtttggttg |
15661879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 19062010 - 19061942
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||| |||||||| || ||||||||| |
|
|
| T |
19062010 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacctagtgggataaggcttggttg |
19061942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 23906372 - 23906304
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
23906372 |
tatgatagaacactatggcgtcatttgatccatgtagctgaccccacttagtgggataaggcttggttg |
23906304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 48174168 - 48174100
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
48174168 |
tatgataaaacattatggcgtcatttgatccatgtagcagaccccacttagtgggataaggcttggttg |
48174100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 48622618 - 48622550
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
48622618 |
tatgatagaacactatggcgtcatttaatccatgtagccgaccccacttagtgggataaggcttggttg |
48622550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 268 - 323
Target Start/End: Original strand, 4441060 - 4441115
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
4441060 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtggga |
4441115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 269 - 336
Target Start/End: Original strand, 37488299 - 37488366
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| ||||||||||||||| || ||||||||| |
|
|
| T |
37488299 |
atgatagagcattatggcgtaatttgatccatgtagccagccccacttagtgggataaggcttggttg |
37488366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 3979125 - 3979195
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |||||| || |||| |||||||| || ||||||||| |
|
|
| T |
3979125 |
tttatgatagaacattatgacgtaatttgatccatgtagcctactccacatagtgggataaggcttggttg |
3979195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 4548227 - 4548297
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| || |||||||||||||||| |||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
4548227 |
tttatgatagaacactaaggcgtaatttgatccatgtagccaacccaacttagtgggataatgcttggttg |
4548297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 7947142 - 7947212
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
7947142 |
tttatgatagaacactatcatgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
7947212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 8286644 - 8286714
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||| ||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
8286644 |
tttatgatagaacactatgacgtcatttgatccatgtagccgcccccacttagtgggataaggcttggttg |
8286714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 13805342 - 13805272
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||| |||||||||||||||| | ||||||||| |
|
|
| T |
13805342 |
tttatgatagaacattatgggataatttgatccatgtagccaaccccacttagtgggatatggcttggttg |
13805272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 19154940 - 19154870
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| | ||| ||||||||||||||||| || ||||||||| |
|
|
| T |
19154940 |
tttatgatagaacactatggcgttatttgatccatgcagctgaccccacttagtgggataaggcttggttg |
19154870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 19969386 - 19969456
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
19969386 |
tttatgatagaacgctatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
19969456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 25575029 - 25575099
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| ||||| ||||||| ||||||||| || ||||||||| |
|
|
| T |
25575029 |
tttatgatagaacattgtggtgtaatttgatccatgtagcagaccccatttagtgggataaggcttggttg |
25575099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 28236387 - 28236457
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| | ||||||||||||||||||||||| || |||||||| |
|
|
| T |
28236387 |
tttatgatagaatattatggtgtaatttgatctatgtagccgaccccacttagtgggataagacttggttg |
28236457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 282 - 336
Target Start/End: Complemental strand, 30634167 - 30634113
Alignment:
| Q |
282 |
atggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
30634167 |
atggcgtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
30634113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 39708638 - 39708708
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||| |||| |||||||||||||||||| || |||||||| |
|
|
| T |
39708638 |
tttatgatagaacactatgtcgtaatttgatccatgtagtcgaccccacttagtgggataagacttggttg |
39708708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 49939807 - 49939741
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||| ||||| |
|
|
| T |
49939807 |
tgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggctcggttg |
49939741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 55388288 - 55388218
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||| || | |||||||||||||||||| || ||||||||| |
|
|
| T |
55388288 |
tttatgatagaacattgtggtgtaatttgatccatgttgtcgaccccacttagtgggataaggcttggttg |
55388218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 1965710 - 1965653
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
1965710 |
tttatgatagaataatatggcgtaatttgatccacgtagccgatcccatttagtggga |
1965653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 6957805 - 6957873
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||| |||||||||||||| || ||||||||| |
|
|
| T |
6957805 |
tatgatagaacactatgacgtcatttgatccatgtagccgatcccacttagtgggataaggcttggttg |
6957873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 7544605 - 7544538
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
7544605 |
tatgatagaacattatagcg-aatttgatccatgtagccgaccccacttagtgggataagccttggttg |
7544538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 20192240 - 20192307
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| ||| |||||||| | ||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
20192240 |
tatgatagaacattatgacgttatttgatcaa-gtagccgaccctacttagtgggataaagcttggttg |
20192307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 272 - 328
Target Start/End: Original strand, 28467649 - 28467705
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaag |
328 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||| |||||||||| |||| |
|
|
| T |
28467649 |
atagaacattatggcgtaatttgatccatgtagcggaccccgcttagtgggaaaaag |
28467705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 50967103 - 50967035
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||| |||||| |||||||||||||| |||||||||| |||||||||| | |||||||||||| |
|
|
| T |
50967103 |
tatgaaagaaaattatgtcgtaatttgatccatgtagccgacctcacttagtggaataaagcttggttg |
50967035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 335
Target Start/End: Complemental strand, 47265270 - 47265203
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||| ||| | ||||||||||||| |||||||||| |||||||||||| || |||||||| |
|
|
| T |
47265270 |
tatgatagaacactatagtgtaatttgatccatgtagccgacctcacttagtgggataaggcttggtt |
47265203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 50238677 - 50238622
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
50238677 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
50238622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 281 - 336
Target Start/End: Complemental strand, 50238763 - 50238708
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
50238763 |
tatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
50238708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 1095650 - 1095720
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | ||| |||||||| ||||||||| || ||||||||| |
|
|
| T |
1095650 |
tttatgatagaacattatggcgttatttgatcgatgtacccgaccccgtttagtgggataaggcttggttg |
1095720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 21528497 - 21528563
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||||| | |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
21528497 |
tgatagaacactatggtggcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
21528563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 31459203 - 31459269
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| ||||||||||||| || |||||||| ||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
31459203 |
tgattgaacattatggcggaacttgatccatgtacccgaccccacttagtgggataaggcttggttg |
31459269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 32633479 - 32633413
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| ||||||| || |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
32633479 |
tgatagaacactatggcgtcatttgatacatgtagccaaccccacttagtgggaaaaggcttggttg |
32633413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 34208346 - 34208276
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| ||||||| |||| ||||| || ||||||||| |
|
|
| T |
34208346 |
tttatgatagaacattatggcgcaatttgatccatgtactcgaccccccttattgggataaggcttggttg |
34208276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 37042737 - 37042671
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||| || ||||||||| ||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
37042737 |
tgatagaacattatggtgtcgtttgatccatgtagccgacccgacttagtgggataaggcttggttg |
37042671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45204916 - 45204847
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | |||||| |||| ||||||||||| || ||||||||| |
|
|
| T |
45204916 |
tttatgatagaacatta-ggcgtaatttgatctatgtagcccacccaacttagtgggataaggcttggttg |
45204847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 51438650 - 51438720
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| ||||| ||||| |||| |||||| || ||||||||| |
|
|
| T |
51438650 |
tttataatataacattatggcgtaatttgatccatgtagctgacccaactttgtgggataaggcttggttg |
51438720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 53540495 - 53540565
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||| |||||||| ||||||| || |||||||| |
|
|
| T |
53540495 |
tttatgatagaacattatggcataatttgatccatatagccaaccccactgagtgggataagacttggttg |
53540565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 54935354 - 54935424
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| | |||||||||||| |||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
54935354 |
tttatgatagaacattataacataatttgatccatgtagcctaccccacttggtgggacagggcttggttg |
54935424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 279 - 336
Target Start/End: Original strand, 15665319 - 15665376
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
15665319 |
attacggcgtaatttgatccatgtagctgaccccacttagtgggataaggcttggttg |
15665376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 275 - 336
Target Start/End: Complemental strand, 21359293 - 21359232
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||||||||||||||| || |||| |||| |
|
|
| T |
21359293 |
gaacattatggcgtaatttgattcatgcagccgaccccacttagtgggataaggctttgttg |
21359232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 331
Target Start/End: Complemental strand, 36799734 - 36799669
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagctt |
331 |
Q |
| |
|
|||||||| ||||| ||| || |||||||||||| |||| |||||||||||||||||| ||||||| |
|
|
| T |
36799734 |
tttatgattgaacaatatcgcataatttgatccatgtagacgaccccacttagtgggataaagctt |
36799669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 268 - 321
Target Start/End: Complemental strand, 40018264 - 40018211
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40018264 |
tatgatagaacattacggcgtcgtttgatccatgtagccgaccccacttagtgg |
40018211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 287 - 336
Target Start/End: Original strand, 50862857 - 50862906
Alignment:
| Q |
287 |
gtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
50862857 |
gtaatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
50862906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 53518400 - 53518344
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
53518400 |
tttatgatagaacactatggcgtaatttgatccatgcag-cgaccccacttagtggga |
53518344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 12494870 - 12494938
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||| ||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
12494870 |
tatgatagaacactatgacgtcatttaatccatgtagcggaccccacttagtgggataaggcttggttg |
12494938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 21237065 - 21237133
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| ||||||| || |||||| |||||||||||||||| || | ||||||| |
|
|
| T |
21237065 |
tatgatagaacactatggcgtcatttgatacatgtagccaaccccacttagtgggataaggattggttg |
21237133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 33190923 - 33190855
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||| ||| |||||||||||||| |||||||| || ||||||||| |
|
|
| T |
33190923 |
tatgatagaacactatgacgtcatttgacccatgtagccgaccccacctagtgggataaggcttggttg |
33190855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 49738625 - 49738557
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||||||||||||| ||||||||| || ||||||||| |
|
|
| T |
49738625 |
tatgacagaacattatggcggtgtttgatccatgtagccgaccccatttagtgggataaggcttggttg |
49738557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 56375497 - 56375565
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||||| |||||||||||| || |||||||| |
|
|
| T |
56375497 |
tatgatagaacactatgacgtcatttgatccatgtagccgacctcacttagtgggataagacttggttg |
56375565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 2557749 - 2557678
Alignment:
| Q |
266 |
tttatgatagaacattat-ggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |||||| || ||| ||||||||| || ||||||||| |
|
|
| T |
2557749 |
tttatgatagaacattattggtgtaatttgatccatgtagccaactccatttagtgggataaggcttggttg |
2557678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 313
Target Start/End: Original strand, 12443300 - 12443347
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgacccca |
313 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||| |||| |
|
|
| T |
12443300 |
tttatgatagaacattatggcataatttgatccatgtagccgatccca |
12443347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 267 - 334
Target Start/End: Complemental strand, 22873675 - 22873608
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
||||||||||||||||| |||||||| ||||| |||||| |||||| ||||||||| || ||||||| |
|
|
| T |
22873675 |
ttatgatagaacattataacgtaatttaatccatgtagccaaccccatttagtgggataaggcttggt |
22873608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 266 - 321
Target Start/End: Original strand, 51176779 - 51176834
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||| ||||| |||| |||||||||| |
|
|
| T |
51176779 |
tttaggatagaacattatggcataatttgatccatgtagcggaccacacttagtgg |
51176834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 5306501 - 5306571
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||| ||||||||| |||||| || ||||||||| |
|
|
| T |
5306501 |
tttatgacataacattatggcgtaatttgatccatatagctaaccccacttggtgggataaggcttggttg |
5306571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 268 - 334
Target Start/End: Complemental strand, 20105593 - 20105527
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| |||||| | | |||||||| |||||| ||||||| |
|
|
| T |
20105593 |
tatgataggacattatggcgtcatttgatccatgtagccaatctcacttagtaggacaaggcttggt |
20105527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 34585691 - 34585757
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||||||||||||| |||||||||| ||||| | |||||||||||||| || ||||||||| |
|
|
| T |
34585691 |
tgataaaacattatggcgtcatttgatccatgtagcttaacccacttagtgggataaggcttggttg |
34585757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 45184210 - 45184140
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||| ||||||||| ||||||| ||| || ||||||||||||||||||||||| || |||| |||| |
|
|
| T |
45184210 |
tttataataaaacattatgacgtaattcgattcatgtagccgaccccacttagtgggataaggcttagttg |
45184140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 266 - 320
Target Start/End: Complemental strand, 56439648 - 56439594
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtg |
320 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
56439648 |
tttatgatagaacattatagcgtaatttaatccatatagccaaccccacttagtg |
56439594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 270 - 323
Target Start/End: Complemental strand, 8599014 - 8598961
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| |||||| || ||||||||| ||||||||||||| |
|
|
| T |
8599014 |
tgatagaacattatggcgtcgtttgattcatgtagccgacgccacttagtggga |
8598961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 20601729 - 20601672
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || ||| | || |||||||||||||| |
|
|
| T |
20601729 |
tttatgatagaacattatgacgtaatttgattcatgtaactgaacccacttagtggga |
20601672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 335
Target Start/End: Original strand, 37798056 - 37798125
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggtt |
335 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||| | ||||||||| ||| ||||||||| || |||||||| |
|
|
| T |
37798056 |
tttatgatagaacaatatgacgtcatttgatcaatgtagccgactccatttagtgggataaggcttggtt |
37798125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 266 - 299
Target Start/End: Complemental strand, 42489653 - 42489620
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatcca |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42489653 |
tttatgatagaacattatggcgtaatttgatcca |
42489620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 43434134 - 43434199
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| || ||||| |||||||||| |||| ||| |||||||||||||| || ||||||||| |
|
|
| T |
43434134 |
gatagaacactacggcgtcatttgatccatgtagtcgagcccacttagtgggataaggcttggttg |
43434199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 281 - 334
Target Start/End: Original strand, 46236709 - 46236762
Alignment:
| Q |
281 |
tatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggt |
334 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| ||| || ||||||| |
|
|
| T |
46236709 |
tatggcgtactttgatccatgtagccgaccccacttagtaggataaggcttggt |
46236762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 336
Target Start/End: Original strand, 13296648 - 13296708
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| |||||||||||| || | |||||||| |||||||||||| || ||||||||| |
|
|
| T |
13296648 |
aacattatagcgtaatttgatgcatgcagccgacctcacttagtgggaaaatgcttggttg |
13296708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 29209250 - 29209182
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||| ||||||| | ||||||||||||||||| ||||| || |||||||| |
|
|
| T |
29209250 |
tatgatagagcattatggcgttgtttgatcaatgtagccgaccccacttaatgggataagacttggttg |
29209182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 33227416 - 33227484
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||| |||||||| ||||| |||||| | || ||||||||| |
|
|
| T |
33227416 |
tatgatagaacactatgacgtcatttgatccatgtagccgatcccacctagtggaataaggcttggttg |
33227484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 332
Target Start/End: Complemental strand, 40932999 - 40932935
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||||||||| |||||| || |||||||||||||||| |||||| || ||||| |
|
|
| T |
40932999 |
tatgatagaacattatggcggcgtttgatgcatgtagccgaccccacttggtgggataaggcttg |
40932935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 49686900 - 49686968
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||| |||||||||| ||||| ||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
49686900 |
tatgatggaatattatggcgtcgtttgaaccatgtagccgaccccacttagtgggataagacttggttg |
49686968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Original strand, 8284346 - 8284401
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| ||||||| || ||||||||||| |
|
|
| T |
8284346 |
tatgatagatcattatggcgtcatttgatccatatagccgatcctacttagtggga |
8284401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 17666125 - 17666070
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| |||| |||| || |||||| |||| |||||||||||||||||| |
|
|
| T |
17666125 |
tatgatagaacaatatgacgtatttcgatccatgtagtcgaccccacttagtggga |
17666070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 336
Target Start/End: Complemental strand, 22420791 - 22420724
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||||||||| ||||||| | |||| ||||||||||||||||| || ||||||||| |
|
|
| T |
22420791 |
atgatagagcattatggcgttgtttgatctatgtagttgaccccacttagtgggataaggcttggttg |
22420724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 27338462 - 27338407
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||| |||| || |||||| ||||||||||| |||||||||| |
|
|
| T |
27338462 |
tatgatagaacattatgacgtagttggatccatgtagccgaccctccttagtggga |
27338407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 251 - 322
Target Start/End: Original strand, 28351749 - 28351820
Alignment:
| Q |
251 |
tggatcaaaatacattttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggg |
322 |
Q |
| |
|
|||||| ||||| | ||||| |||||| |||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
28351749 |
tggatccaaatatagtttatagtagaaccttatggaattatttgatccatgtagccgaccccacttagtggg |
28351820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 269 - 332
Target Start/End: Original strand, 31339732 - 31339795
Alignment:
| Q |
269 |
atgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||||||| ||| |||| |||| ||| ||||||||||||||||||| || ||||| |
|
|
| T |
31339732 |
atgatagaacattatgacgtcgtttggtccatgtatccgaccccacttagtgggataaggcttg |
31339795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 293 - 336
Target Start/End: Original strand, 46153940 - 46153983
Alignment:
| Q |
293 |
tgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
46153940 |
tgatccatgtagccgaccccacttagtgggataaggcttggttg |
46153983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 31961339 - 31961273
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||| ||| |||||| || |||||||||| |||||||||||| || ||||||||| |
|
|
| T |
31961339 |
tgatagaacactatgacgtcgtttgattcatgtagccgacctcacttagtgggataaggcttggttg |
31961273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 316
Target Start/End: Original strand, 34379608 - 34379657
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccactt |
316 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
34379608 |
tttatgatagaatattatggcgtaacttgat-catgtagccgaccccactt |
34379657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 336
Target Start/End: Complemental strand, 35555723 - 35555657
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| ||| |||||||| |||||| || ||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
35555723 |
tgatagtacagtatggcgtcgtttgattcatgtagccgactccatttagtgggacaaggcttggttg |
35555657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 270 - 332
Target Start/End: Complemental strand, 51811351 - 51811290
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||| |||| ||| |||||||||| |||||||| |||||||||||||| || ||||| |
|
|
| T |
51811351 |
tgatagaacactatgacgtcatttgatccatgtagccga-cccacttagtgggataaggcttg |
51811290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 278 - 336
Target Start/End: Original strand, 54470424 - 54470482
Alignment:
| Q |
278 |
cattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||| |||| |||||||||| |||||| |||||||||||||||| | ||||||||| |
|
|
| T |
54470424 |
cattattgcgtcatttgatccatgtagccaaccccacttagtgggattaggcttggttg |
54470482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 287 - 336
Target Start/End: Complemental strand, 4879165 - 4879116
Alignment:
| Q |
287 |
gtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||| |||||| ||||| || ||||||||| |
|
|
| T |
4879165 |
gtaatttgatccatgtagccgacctcacttactgggataaggcttggttg |
4879116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 275 - 336
Target Start/End: Original strand, 28348271 - 28348332
Alignment:
| Q |
275 |
gaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| ||| ||||| ||| |||||||||||| |||||||||| || ||||||||| |
|
|
| T |
28348271 |
gaacattatgatgtactttgaaccatgtagccgaccccgcttagtgggataaggcttggttg |
28348332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 295 - 336
Target Start/End: Original strand, 56130404 - 56130445
Alignment:
| Q |
295 |
atccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
56130404 |
atccatgtagccgaccccacttagtgggataaggcttggttg |
56130445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 276 - 336
Target Start/End: Complemental strand, 4136810 - 4136750
Alignment:
| Q |
276 |
aacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| ||||| ||||||||| ||||||||||| |||||||| || ||| |||||||| |
|
|
| T |
4136810 |
aacattacggcgttgtttgatccatgtagccgaccctacttagtgagataaaacttggttg |
4136750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 271 - 323
Target Start/End: Complemental strand, 6958310 - 6958258
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||| |||||||| |||||| || ||||||||||| ||||||||||| |
|
|
| T |
6958310 |
gatagaacactatggcgtcgtttgattcatgtagccgaccctacttagtggga |
6958258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 279 - 323
Target Start/End: Complemental strand, 11400509 - 11400465
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
11400509 |
attatggtgtaatttcatccatgtagccgacccaacttagtggga |
11400465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 279 - 323
Target Start/End: Complemental strand, 11410236 - 11410192
Alignment:
| Q |
279 |
attatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||| ||||||||||| |
|
|
| T |
11410236 |
attatggtgtaatttcatccatgtagccgacccaacttagtggga |
11410192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 332
Target Start/End: Original strand, 20999207 - 20999271
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||| |||| ||||||| ||| |||||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
20999207 |
tatggtagagcattatgacgtcgtttgatccttgtagccgaccccactcagtgggataaagcttg |
20999271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 280 - 336
Target Start/End: Complemental strand, 26275079 - 26275023
Alignment:
| Q |
280 |
ttatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||||| ||||| ||| || ||||||||| |
|
|
| T |
26275079 |
ttatggcctaatttgatccatgtatccgaccccatttagttggaaaaggcttggttg |
26275023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 266 - 310
Target Start/End: Original strand, 30480328 - 30480372
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgacc |
310 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
30480328 |
tttatgatagaattttatgacgtaatttgatccatgtagccgacc |
30480372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 31403109 - 31403041
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| |||||||| || |||||||| |||| |||||||||||||| ||| ||| |||||||| |
|
|
| T |
31403109 |
tatgatagagcattatggtgttgcttgatccatgtagacgaccccacttagtaggataaaacttggttg |
31403041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 277 - 321
Target Start/End: Complemental strand, 38585317 - 38585273
Alignment:
| Q |
277 |
acattatggcgtaatttgatccacgtagccgaccccacttagtgg |
321 |
Q |
| |
|
||||||||||||||||||||||| |||| || |||||||||||| |
|
|
| T |
38585317 |
acattatggcgtaatttgatccatttagctgagcccacttagtgg |
38585273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 272 - 336
Target Start/End: Complemental strand, 44719432 - 44719368
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| |||||||| || ||||||||| ||||||||||| ||||||||||| || |||||||| |
|
|
| T |
44719432 |
atagagcattatggtgtcgtttgatccatgtagccgaccctacttagtgggataagacttggttg |
44719368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 46582900 - 46582833
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||| | |||||||||| ||| || ||||||||| |
|
|
| T |
46582900 |
tatgatagaaccctatggcgtcatttgatccatgtagccta-cccacttagtaggataaggcttggttg |
46582833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 51841273 - 51841205
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||| |||||||||||| ||||||||| |||| |||||| |||||||||| ||||||||||| |
|
|
| T |
51841273 |
tatgatacaacattatggcggtgtttgatccatatagctgaccccgcttagtgggatgaagcttggttg |
51841205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 28964 - 28896
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
28964 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
28896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0692 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0692
Description:
Target: scaffold0692; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 4841 - 4911
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||| |||||| || ||||||||| |
|
|
| T |
4841 |
tttatgatagaacactatggcgtaatttgatccgtgtagccgaccccactttgtgggataacgcttggttg |
4911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 160401 - 160331
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| |||||||||||||||| || ||||||||| |
|
|
| T |
160401 |
tttatgatagaacattatggcgtaatttgaatcatgtagccaaccccacttagtgggaaaaggcttggttg |
160331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 266 - 323
Target Start/End: Complemental strand, 58303 - 58246
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
58303 |
tttatgatagaacattatgtcgtaatttgatccatgtagccgacccaacttagtggga |
58246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 273 - 336
Target Start/End: Complemental strand, 45514 - 45452
Alignment:
| Q |
273 |
tagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| || | |||| |||| |||||||||||| |
|
|
| T |
45514 |
tagaacattatagcgtaatttgatccatgtagccga-cctatttagcgggaaaaagcttggttg |
45452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1318 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold1318
Description:
Target: scaffold1318; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 268 - 332
Target Start/End: Original strand, 538 - 602
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttg |
332 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||||||||||||||| || ||||| |
|
|
| T |
538 |
tatgatagaacactatggcgtcatttgatccatgtagccgaccccacttagtgggataaggcttg |
602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0491 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0491
Description:
Target: scaffold0491; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 272 - 336
Target Start/End: Original strand, 3648 - 3712
Alignment:
| Q |
272 |
atagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||||| |
|
|
| T |
3648 |
atagaacattatgacgtaatttgatccaagtagccgaccccacttagtgggataagacttggttg |
3712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1284 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold1284
Description:
Target: scaffold1284; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 1916 - 2006
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatactt-ccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | |||| | || ||||||||||||||||| || |||||||||||| |
|
|
| T |
1916 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacacttactacatttcagaattttaaaaccatgattgaattgcag |
2006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 14788 - 14858
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||| |||||| ||||||| |||||||| ||| |||||||| |
|
|
| T |
14788 |
tttatgattgaacactatggcgtaatttgatccatgtagccaaccccacgtagtgggataaatcttggttg |
14858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 161295 - 161385
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
161295 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
161385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 99
Target Start/End: Original strand, 175441 - 175531
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattgcag |
99 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||| |||||||| | || ||| || ||||||||||||||||| || |||||||||||| |
|
|
| T |
175441 |
ttattctagatacacatggatatatcctctgaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattgcag |
175531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 11 - 96
Target Start/End: Original strand, 170597 - 170684
Alignment:
| Q |
11 |
ttattctagatacacatggatttatcatctgaaacttaaatctcatatac-ttccacctttcagaattttaaaacaat-attgaattg |
96 |
Q |
| |
|
|||||||||||||||||| || |||| ||| ||||| |||||||| | || ||| || ||||||||||||||||| || ||||||||| |
|
|
| T |
170597 |
ttattctagatacacatgtatatatcctctaaaactcaaatctcacacactttctacatttcagaattttaaaaccatgattgaattg |
170684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0392 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0392
Description:
Target: scaffold0392; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 268 - 333
Target Start/End: Complemental strand, 6847 - 6782
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttgg |
333 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |||||| |||||||||||||||| || |||||| |
|
|
| T |
6847 |
tatgatataacattatggcataatttgatccatgtagccaaccccacttagtgggataaggcttgg |
6782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0570 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0570
Description:
Target: scaffold0570; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 1023 - 955
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||| ||||||| ||||||||| || ||||||||| |
|
|
| T |
1023 |
tatgatagaacactatggcgtcatttgatccatgtagctgaccccatttagtgggataaggcttggttg |
955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 48191 - 48140
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagt |
319 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
48191 |
tatgatagaatattatggcgtaatttgatccatgtagccgactccacttagt |
48140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Original strand, 82923 - 82993
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||| ||||||||||||||||| ||| | || ||||||||| |
|
|
| T |
82923 |
tttatgatagaacactatgacgtcatttgatccatgtagccgaccccacttaatggaataaggcttggttg |
82993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0245 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0245
Description:
Target: scaffold0245; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 16513 - 16443
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||||||| ||| ||| || |||| |||| |
|
|
| T |
16513 |
tttatgatagaacattatggcataatttgatccatgtggccgaccccactcagttggataaggcttagttg |
16443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 270 - 336
Target Start/End: Original strand, 16787 - 16853
Alignment:
| Q |
270 |
tgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||| |||||||| |||||||| | ||||||||| ||||||||||||| || ||||||||| |
|
|
| T |
16787 |
tgatagaacactatggcgtcatttgatctatgtagccgactccacttagtgggataaggcttggttg |
16853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 271 - 336
Target Start/End: Original strand, 7650 - 7715
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||| | ||||||||||||| |||||||||||| |
|
|
| T |
7650 |
gatagaacactatggcgtaatttgatccatgcagccatctccacttagtgggataaagcttggttg |
7715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Complemental strand, 25607 - 25539
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| |||| ||| |||| ||||| ||||| ||||||||||||||||| || ||||||||| |
|
|
| T |
25607 |
tatgatagaacactatgacgtcatttaatccatgtagcggaccccacttagtgggataaggcttggttg |
25539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 268 - 336
Target Start/End: Original strand, 31675 - 31743
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||| | || || |||||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
31675 |
tatgatagaacactgtgaagtcatttgatccatgtagccgaccccacttagtgggataaggcttggttg |
31743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1259 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold1259
Description:
Target: scaffold1259; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 271 - 336
Target Start/End: Complemental strand, 1594 - 1529
Alignment:
| Q |
271 |
gatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||| |||||||||||| | ||||| ||||||||||| | || |||||||||||| |
|
|
| T |
1594 |
gatagaacattatgacgtaatttgatcaatgtagctgaccccacttattaagataaagcttggttg |
1529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0221 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0221
Description:
Target: scaffold0221; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 293 - 336
Target Start/End: Original strand, 19149 - 19192
Alignment:
| Q |
293 |
tgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||| ||||||| |
|
|
| T |
19149 |
tgatccacgtagccgaccccacttagtgagataaagtttggttg |
19192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 268 - 323
Target Start/End: Complemental strand, 86684 - 86629
Alignment:
| Q |
268 |
tatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtggga |
323 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |||| || | ||||||||||||| |
|
|
| T |
86684 |
tatgatagaacactatgacgtaatttgatccatgtagtcggctccacttagtggga |
86629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1858 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold1858
Description:
Target: scaffold1858; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 266 - 336
Target Start/End: Complemental strand, 952 - 883
Alignment:
| Q |
266 |
tttatgatagaacattatggcgtaatttgatccacgtagccgaccccacttagtgggacaaagcttggttg |
336 |
Q |
| |
|
||||| ||| ||||||||||| ||||||| || | ||||||||||||||||||||||| || |||||||| |
|
|
| T |
952 |
tttataataaaacattatggcataatttgttc-aggtagccgaccccacttagtgggataacacttggttg |
883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 267 - 296
Target Start/End: Original strand, 66744 - 66773
Alignment:
| Q |
267 |
ttatgatagaacattatggcgtaatttgat |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
66744 |
ttatgatagaacattatggcgtaatttgat |
66773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University