View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18439_high_6 (Length: 240)
Name: NF18439_high_6
Description: NF18439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18439_high_6 |
 |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0092 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 22392 - 22616
Alignment:
| Q |
8 |
atcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatccaacaaggaggtccatgaaaaccagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22392 |
atcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatcgaacaaggaggtccatgaaaaccagg |
22491 |
T |
 |
| Q |
108 |
tgataaatagaggatgtttatttac-cnnnnnnnnnaggatttcttgctatgaaactatgtgattggtctaggtcaaactatttacattttatataggga |
206 |
Q |
| |
|
||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22492 |
tgaaaaatagaggatgttt-tttactttttttttttaggatttcttgctatgaaactatgtgattggtctaggtccaactatttacattttatataggga |
22590 |
T |
 |
| Q |
207 |
ttttatttaccatcactatgatgatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
22591 |
ttttatttaccatcactatgatgatg |
22616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University