View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18439_high_6 (Length: 240)

Name: NF18439_high_6
Description: NF18439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18439_high_6
NF18439_high_6
[»] scaffold0092 (1 HSPs)
scaffold0092 (8-232)||(22392-22616)


Alignment Details
Target: scaffold0092 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: scaffold0092
Description:

Target: scaffold0092; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 8 - 232
Target Start/End: Original strand, 22392 - 22616
Alignment:
8 atcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatccaacaaggaggtccatgaaaaccagg 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
22392 atcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatcgaacaaggaggtccatgaaaaccagg 22491  T
108 tgataaatagaggatgtttatttac-cnnnnnnnnnaggatttcttgctatgaaactatgtgattggtctaggtcaaactatttacattttatataggga 206  Q
    ||| ||||||||||||||| |||||           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
22492 tgaaaaatagaggatgttt-tttactttttttttttaggatttcttgctatgaaactatgtgattggtctaggtccaactatttacattttatataggga 22590  T
207 ttttatttaccatcactatgatgatg 232  Q
    ||||||||||||||||||||||||||    
22591 ttttatttaccatcactatgatgatg 22616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University