View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18439_low_7 (Length: 413)
Name: NF18439_low_7
Description: NF18439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18439_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 14 - 403
Target Start/End: Original strand, 40924683 - 40925068
Alignment:
| Q |
14 |
cacagaaaacttcattccgaccatgtatcattcaaaaccctccaatttcaatcagcaacagctagctagtttcccattgacgacaacatgccttgttctt |
113 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40924683 |
cacagaaaacttcattccgaccatatatcattcaaaacccgccaatttcaatcagcaacagctagctagtttcccattgacgacg---tgccttgttctt |
40924779 |
T |
 |
| Q |
114 |
ggtccttcccagcttgtctcagaattcttctccagaacggatgagtttcaaaaaggcgatgaacatcctcaaagaaatgtacttgttgttacctgcattg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40924780 |
ggtccttcccagcttgtctcagaattcttctccagaacggatgagtttcaaaaaggcgatgaacatcctcaaagaaatgtacttgttgttacctgtattg |
40924879 |
T |
 |
| Q |
214 |
tgtcttcattggactcaatcttgctccggcggtagtgcctgcacgacgttcaactcagtgaggggcaaaggtgccaccgctgcccgtggtggtttgggag |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40924880 |
tgtcttcattggactcaatcttgctccggcggtagtgcctgcacgacg-tcaactcagtgaggggcaaaggtgccaccgctgcccgtggtggtttgggag |
40924978 |
T |
 |
| Q |
314 |
gtgaacgcagccattttaagaaagttggactgtatgccaagatcaatatcactgcaatagcaaccacaacaatggaagcaaacagtataa |
403 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40924979 |
gtgaacgcagccattttaagaaagttggaccgtatgccaagatcaatatcactgcaatagcaaccacaacaatggaagcaaacagtataa |
40925068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University