View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18440_high_22 (Length: 243)
Name: NF18440_high_22
Description: NF18440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18440_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 157
Target Start/End: Complemental strand, 54236236 - 54236091
Alignment:
| Q |
12 |
atgaagacagaccaaacaaaaattcaatcatataaaagaaagaaagctgtaatattgatcttattttactatcatcatattatcaatttaacaaccgaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54236236 |
atgaagacagaccaaacaaaaattcaatcatataaaagaaagaaagctgtgatattgatcttattttactatcatcatattatcaatttaacaaccgaat |
54236137 |
T |
 |
| Q |
112 |
tcaatcccgagcttagttagaatgcaacgatatactagctagcttc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54236136 |
tcaatcccgagcttagttagaatgcaacgatatactagctagcttc |
54236091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University