View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18440_high_27 (Length: 226)

Name: NF18440_high_27
Description: NF18440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18440_high_27
NF18440_high_27
[»] chr7 (1 HSPs)
chr7 (57-184)||(30346079-30346206)


Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 57 - 184
Target Start/End: Complemental strand, 30346206 - 30346079
Alignment:
57 ataaatcttactataatatcattagatcaaatgtgatatgacgtgacttgttgatctaataagtagaaaatttatctgcacatggtgcagtacaagtgct 156  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
30346206 ataagtcttactataatatcattagatcaaatgtgatatgacgtgacttgttgatctaataagtagaaaatttatctgcgcatggtgcagtacaagtgct 30346107  T
157 gatttcctctaatagtaatgcttactaa 184  Q
    ||||||||||||||||||||||||||||    
30346106 gatttcctctaatagtaatgcttactaa 30346079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University