View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18440_low_20 (Length: 249)
Name: NF18440_low_20
Description: NF18440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18440_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 22085447 - 22085211
Alignment:
| Q |
1 |
agatagaaacaatttacattttctaaactcggatccagtgactccgtagtggctgcaatatttggaagctatagaaaattgaaacactaaaagaatatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
22085447 |
agatagaaacaatttacattttctaaactcggatccagtgactccgtagtggctgcaatatttggaagcaatagaaaattgaaacactaaaagaatatag |
22085348 |
T |
 |
| Q |
101 |
aaatcttggtgatcaattagtttaaacgtttagtctatatccaacaattagcatttaaatttcaaatgtccttaatttcatgattttaatggcggtcgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22085347 |
aaatcttggtgatcaattagtttaaacgtttagtctatatccaacaattagcatttaaatttcaaatgtccttaatttcatgattttaatggcggttgca |
22085248 |
T |
 |
| Q |
201 |
gttgcggccaatgcaaccgaaaaagtagttttgatat |
237 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22085247 |
gttgcggccaatgcaaccgaaaaagaagttttgatat |
22085211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University