View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18440_low_23 (Length: 242)
Name: NF18440_low_23
Description: NF18440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18440_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 228
Target Start/End: Complemental strand, 42182729 - 42182516
Alignment:
| Q |
18 |
atcaaccaccaaaattaactttttcaggtaaggaagatagtgctgtttctaaataggagtaggggtaatgaaatgataatgaatatgatatgataatata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
42182729 |
atcaaccaccaaaattaactttttcaggtaaggaagatagtgctgtttctaaataggagtaggggtaatgaaatgataatgcatatgatatggtaatata |
42182630 |
T |
 |
| Q |
118 |
tagta---tagtagtacagcaacaaaggctaggcttgaggcatgtaaagaagacaggtgttggaatggagagatttatgattgtgttatgggttgccgcc |
214 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42182629 |
tagtagtatagtagtacagcaacaaaggctaggcttgaggcatgtaaagaagacaggtgttggaatggagagatttatgattgtgttatgggttgccgcc |
42182530 |
T |
 |
| Q |
215 |
attctcggcctttg |
228 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42182529 |
attctcggcctttg |
42182516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 157 - 228
Target Start/End: Complemental strand, 17366217 - 17366146
Alignment:
| Q |
157 |
tgtaaagaagacaggtgttggaatggagagatttatgattgtgttatgggttgccgccattctcggcctttg |
228 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17366217 |
tgtaaagaggacagatgttggaatggagagatttaagattgtgttatgggttgccgccattctcagcctttg |
17366146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University