View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18440_low_27 (Length: 226)
Name: NF18440_low_27
Description: NF18440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18440_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 57 - 184
Target Start/End: Complemental strand, 30346206 - 30346079
Alignment:
| Q |
57 |
ataaatcttactataatatcattagatcaaatgtgatatgacgtgacttgttgatctaataagtagaaaatttatctgcacatggtgcagtacaagtgct |
156 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30346206 |
ataagtcttactataatatcattagatcaaatgtgatatgacgtgacttgttgatctaataagtagaaaatttatctgcgcatggtgcagtacaagtgct |
30346107 |
T |
|
| Q |
157 |
gatttcctctaatagtaatgcttactaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
30346106 |
gatttcctctaatagtaatgcttactaa |
30346079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University