View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18441_low_8 (Length: 276)
Name: NF18441_low_8
Description: NF18441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18441_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 48 - 256
Target Start/End: Complemental strand, 8738453 - 8738245
Alignment:
| Q |
48 |
tgaatatgttggtaggtttgcatcaatttataatgctacaagaaggaagtgagagagctttgatgttggtacgtcataatttacttttggagcccaaagt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8738453 |
tgaatatgttggtaggtttgcatcaatttataatgctacaagaaggtagtgagagagctttgatgttggtacgtcataatttacttttggagcccaaagt |
8738354 |
T |
|
| Q |
148 |
tgaacaaaaacaaagcatggggaactgtctcttactatatatgtgttgcaaatcagctattaccccagttcctatttatagttcacatgaaaaggattta |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8738353 |
tgaacaaaaacaaagcatggggaactgtctcttactatatatgtgttgcaaatcagctattaccccagttcctatttatagttcacatgaaaaggattta |
8738254 |
T |
|
| Q |
248 |
tagttcata |
256 |
Q |
| |
|
||||||||| |
|
|
| T |
8738253 |
tagttcata |
8738245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 229
Target Start/End: Complemental strand, 8704708 - 8704668
Alignment:
| Q |
189 |
tgtgttgcaaatcagctattaccccagttcctatttatagt |
229 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
8704708 |
tgtgttgctgatcaactattaccccagttcctatttatagt |
8704668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University