View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18442_low_11 (Length: 201)
Name: NF18442_low_11
Description: NF18442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18442_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 10 - 183
Target Start/End: Original strand, 2786164 - 2786337
Alignment:
| Q |
10 |
acatcatcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786164 |
acatcgtcaactttaacatgaatttgatttgaaggcaagtttgttgttccggaaggactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaa |
2786263 |
T |
|
| Q |
110 |
caagagggggtttcgcatcaacaggtggattgacagctccagcattgtagatggctttgattttgggaagattt |
183 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786264 |
caagagggggtttagcatcaaccggtggattgacagctccagcattgtagatggctttgattttgggaagattt |
2786337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 114
Target Start/End: Complemental strand, 22518281 - 22518232
Alignment:
| Q |
65 |
gactcaaggcagtgcgggcttccctgaaaccttctgatatcaaaacaaga |
114 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||| |||| |||| |
|
|
| T |
22518281 |
gactcaaggcactgcgggcttccctaaaaccttctgatattaaaataaga |
22518232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University