View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18442_low_6 (Length: 368)
Name: NF18442_low_6
Description: NF18442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18442_low_6 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 349
Target Start/End: Complemental strand, 18237500 - 18237152
Alignment:
| Q |
1 |
actagtttttggaggggtcgatggattggtaacattcccttgtgtgagcaatttccgcggttgttctctattccaagatgctagctttagggaattaagg |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18237500 |
actaatttttggaggggtcgatggattggtaacattcccttgtgtgagcaatttccgcggttgttctctattccaagatgctaactttagggaattaagg |
18237401 |
T |
|
| Q |
101 |
gttggacatggtgaagagtgaagttgggcgttgtcatggtgtagaactgtgctcgttgtcattgagggaagacgatgataagtggttgtggaagccagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18237400 |
gttggacatggtgaagagtgaagttgggcgttgtcatggtgtagaagtttgctcgttgtcattgagggaagacgatgataagtggttgtggaagccggaa |
18237301 |
T |
|
| Q |
201 |
gaggaaggtgtgggttactgaggggttgcttgttctggataatgattttagtgttgcggttgaattccaactcaaatcaactttattgctttgtttaggt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18237300 |
gaggaaggtgtgggttactgaggggttgcttgttttggataatgattttagtactgcggttgaattccaactcaaatcaaccttattgctttgtttaggt |
18237201 |
T |
|
| Q |
301 |
atctctttgtaaactcctttagaccgtgtcctttgtacgagtaccgtag |
349 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
18237200 |
atctatttgtaaactcctttagaccgtgtcctttgtatgagtactgtag |
18237152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University