View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18442_low_8 (Length: 247)
Name: NF18442_low_8
Description: NF18442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18442_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 29315205 - 29315444
Alignment:
| Q |
1 |
aggttcttggagaattaatgacatattctgaaggtaagggggctagtttaaatcatggtgacagcaagcggttgtttacggatagtcctgtggtggcagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29315205 |
aggttcttggagaattaatgacatattctgaaggtaagggggctagtttaaatcatggtgacagcaagcggttgtttacggatagtcctgtggtggcagt |
29315304 |
T |
|
| Q |
101 |
tggggctggagcaacagcagttttaggagcttcgtctctgaccaaattagtccctatgtcaacactgacaaaggctgttactttcaatactccagcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29315305 |
tggggctggagcaacagcagttttaggagcttcgtctctgaccaaattagtccctatgtcgacactgacaaaggctgttaccttcaatactccagcttct |
29315404 |
T |
|
| Q |
201 |
atcaagattgtattcagccagatgcagaaactactctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29315405 |
ctcaagattgtattcagccagatgcagaaactactctctg |
29315444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 7 - 235
Target Start/End: Original strand, 29309147 - 29309375
Alignment:
| Q |
7 |
ttggagaattaatgacatattctgaaggtaagggggctagtttaaatcatggtgacagcaagcggttgtttacggatagtcctgtggtggcagttggggc |
106 |
Q |
| |
|
||||||| ||||| || ||||||| ||||| |||| ||||||||||||||||||||| ||||| ||| | ||||||| |||||||||||||||||||| |
|
|
| T |
29309147 |
ttggagatttaataacggattctgacggtaaaggggttagtttaaatcatggtgacaggaagcgattgatagcggatagacctgtggtggcagttggggc |
29309246 |
T |
|
| Q |
107 |
tggagcaacagcagttttaggagcttcgtctctgaccaaattagtccctatgtcaacactgacaaaggctgttactttcaatactccagcttctatcaag |
206 |
Q |
| |
|
|||||||||||||||||||||||| || ||| | ||||| |||||||| |||| || ||||| |||| |||||||||||| | |||| |||| ||||| |
|
|
| T |
29309247 |
tggagcaacagcagttttaggagcatcttctttaaccaaggtagtccctgtgtcgacgctgacgaaggttgttactttcaaaattccaacttcactcaag |
29309346 |
T |
|
| Q |
207 |
attgtattcagccagatgcagaaactact |
235 |
Q |
| |
|
||| || ||||||| ||||||||| |||| |
|
|
| T |
29309347 |
attatactcagccaaatgcagaaagtact |
29309375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University