View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18443_high_12 (Length: 258)
Name: NF18443_high_12
Description: NF18443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18443_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 34888941 - 34889062
Alignment:
| Q |
18 |
tatgtctagagactagattgtttcgttagtgtggactcacaaagaaagcaaccaatgtgcggacattttggcgaaatggcaagcataccaatgtacggat |
117 |
Q |
| |
|
|||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34888941 |
tatgtctagagactggattgttttctcagtgtggactcacaaagaaagcaaccaatgtgcggacattttggcgaaatggcaagcataccaatgtacggat |
34889040 |
T |
 |
| Q |
118 |
tatatggcgaaaatgggaggaa |
139 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34889041 |
tatatggcgaaaatgggaggaa |
34889062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 170 - 245
Target Start/End: Original strand, 34034944 - 34035019
Alignment:
| Q |
170 |
caaagccaccaccttgcttatcttctttactttcgagtgatgccaagagaactacatatgtaagagcgtaatttat |
245 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||| ||||||||||||||| | |||||| | ||||| |||||||| |
|
|
| T |
34034944 |
caaagccactaccttacttatcttctttactttctagtgatgccaagagagcaacatatattagagcataatttat |
34035019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University