View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18443_high_15 (Length: 244)
Name: NF18443_high_15
Description: NF18443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18443_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 31192783 - 31193002
Alignment:
| Q |
7 |
aggcaattgttttaaaactcctctaattttccctttcccctcagtaagatggtggaatttatgctcacccttcttctagaaaaatgagactcgtgctgca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
31192783 |
aggcaattgttttaaaactcctctaattttccctttcccctcagtaagatggtggaatttatgctcgctcttcttctagaaaaatgagactcgtgctgca |
31192882 |
T |
|
| Q |
107 |
aatgaatcttcctttgagtgttcaatgaaatcttctctttgtcttccaccctccatgtgaatttttaattgttctttctgcaagtgttaaagtgacatta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31192883 |
aatgaatcttcctttgagtgttcaatgaaatcttctctttgtcttccaccctccaagtgaatttttaattgttctttctgcaagtgttaaagtgacatta |
31192982 |
T |
|
| Q |
207 |
gatggcttcaattgaactac |
226 |
Q |
| |
|
||||||||||| |||||||| |
|
|
| T |
31192983 |
gatggcttcaactgaactac |
31193002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 34390078 - 34390130
Alignment:
| Q |
41 |
ttcccctcagtaagatggtggaatttatgctcacccttcttctagaaaaatga |
93 |
Q |
| |
|
||||||||||||||||| || ||||||||||| |||||||| ||||| ||||| |
|
|
| T |
34390078 |
ttcccctcagtaagatgttgtaatttatgctctcccttcttatagaacaatga |
34390130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University