View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18443_low_13 (Length: 258)

Name: NF18443_low_13
Description: NF18443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18443_low_13
NF18443_low_13
[»] chr6 (1 HSPs)
chr6 (18-139)||(34888941-34889062)
[»] chr4 (1 HSPs)
chr4 (170-245)||(34034944-34035019)


Alignment Details
Target: chr6 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 18 - 139
Target Start/End: Original strand, 34888941 - 34889062
Alignment:
18 tatgtctagagactagattgtttcgttagtgtggactcacaaagaaagcaaccaatgtgcggacattttggcgaaatggcaagcataccaatgtacggat 117  Q
    |||||||||||||| ||||||||  | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34888941 tatgtctagagactggattgttttctcagtgtggactcacaaagaaagcaaccaatgtgcggacattttggcgaaatggcaagcataccaatgtacggat 34889040  T
118 tatatggcgaaaatgggaggaa 139  Q
    ||||||||||||||||||||||    
34889041 tatatggcgaaaatgggaggaa 34889062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 170 - 245
Target Start/End: Original strand, 34034944 - 34035019
Alignment:
170 caaagccaccaccttgcttatcttctttactttcgagtgatgccaagagaactacatatgtaagagcgtaatttat 245  Q
    ||||||||| ||||| |||||||||||||||||| ||||||||||||||| | |||||| | ||||| ||||||||    
34034944 caaagccactaccttacttatcttctttactttctagtgatgccaagagagcaacatatattagagcataatttat 34035019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University