View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18443_low_14 (Length: 256)
Name: NF18443_low_14
Description: NF18443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18443_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 45415917 - 45416098
Alignment:
| Q |
18 |
aagaagtgatagtaataatcaacaaaaacaaacaataattaattccaaaatcaacaagagtcaagaaattatacttatgtagcacttagatggacaattt |
117 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45415917 |
aagaagtgatattaataatcaacaagaacaaacaataattaattccaaaatcaacaagagtcaagaaattatacttatgtagcgcttagatggacaattt |
45416016 |
T |
|
| Q |
118 |
tacttgtttgttacaaagcaaacaacgcgcacgaaatgcacgacactgtatttttcactcaattgcacatgattttcgttaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
45416017 |
tacttgtttgttacaaagcaaacaacgcgcacgaaatgcacgacactgtatttttcacccaatttcacatgattttcgttaa |
45416098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 122 - 199
Target Start/End: Complemental strand, 15441999 - 15441923
Alignment:
| Q |
122 |
tgtttgttacaaagcaaacaacgcgcacgaaatgcacgacactgtatttttcactcaattgcacatgattttcgttaa |
199 |
Q |
| |
|
||||| |||||||||||||||| |||| |||| |||||||| |||| |||||||||||||||||||||||| |||||| |
|
|
| T |
15441999 |
tgtttattacaaagcaaacaacacgcatgaaaggcacgacagtgta-ttttcactcaattgcacatgatttccgttaa |
15441923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University