View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_high_14 (Length: 402)
Name: NF18444_high_14
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 4e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 283 - 392
Target Start/End: Original strand, 27718202 - 27718311
Alignment:
| Q |
283 |
tggcctctacctaaacgcggttactgttgaaactattggttgatgttgtcctcttttgaaatcgctgaaatataggcgttcttatgaaatttatgtgtgt |
382 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27718202 |
tggcctctacctaaacgcggttactattgaaactattggttgattttgtcctcttttgaaatcgctgaaatataggcgttcttatgaaatttatatgtgt |
27718301 |
T |
|
| Q |
383 |
ggtgattcat |
392 |
Q |
| |
|
|||||||||| |
|
|
| T |
27718302 |
ggtgattcat |
27718311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University