View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18444_high_14 (Length: 402)

Name: NF18444_high_14
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18444_high_14
NF18444_high_14
[»] chr4 (1 HSPs)
chr4 (283-392)||(27718202-27718311)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 4e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 283 - 392
Target Start/End: Original strand, 27718202 - 27718311
Alignment:
283 tggcctctacctaaacgcggttactgttgaaactattggttgatgttgtcctcttttgaaatcgctgaaatataggcgttcttatgaaatttatgtgtgt 382  Q
    ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
27718202 tggcctctacctaaacgcggttactattgaaactattggttgattttgtcctcttttgaaatcgctgaaatataggcgttcttatgaaatttatatgtgt 27718301  T
383 ggtgattcat 392  Q
    ||||||||||    
27718302 ggtgattcat 27718311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University