View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_high_38 (Length: 276)
Name: NF18444_high_38
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 122 - 259
Target Start/End: Original strand, 43317994 - 43318131
Alignment:
| Q |
122 |
taatacttgtaaggcgtgtgagtagtatttttcatggtgttggtagcaatacttaatttgttggggtgttggtattgaattgcgtgggtgcatatagtaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43317994 |
taatacttgtaaggcgtgtgagtagtatttttcatggtgttggtagcaatacttaatttgttggggtgttggtattgaattgcgtgggtgcatatagtaa |
43318093 |
T |
|
| Q |
222 |
taccgaatgttcagctcgcccattcttcactgtattct |
259 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43318094 |
taccgaatgttcagctcgcgcattcttcactgtattct |
43318131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 43317846 - 43317919
Alignment:
| Q |
19 |
ctaatcacttccacttatcactttgtcaatgatgtttacaatattgtcaatgtcatatttgatgttctgaaata |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
43317846 |
ctaatcacttccacttatcactttgtcaatgatgtttacaatattgtcaatgtcatattcgacgttctgaaata |
43317919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University