View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_high_45 (Length: 214)
Name: NF18444_high_45
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_high_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 199
Target Start/End: Complemental strand, 38691536 - 38691351
Alignment:
| Q |
14 |
ataatacttgtcattgaatattagatggtacaattttaacattaaattgacccttcatgttacacttaacaggtttgggggttaaagacaaagcaagtca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38691536 |
ataatacttgtcattgaatattagatggtacaattttaacattaaattgacccttcatgttacacttaacaggtttaggggttaaagacaaagcaagtca |
38691437 |
T |
 |
| Q |
114 |
tatgttgtctttaaatgggattgatatatacaataagatctcatggatgcaaatgttgttaatatactaaccgaaaaattgatagc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38691436 |
tatgttgtctttaaatgggattgatatatacaataagatctcatgtatgcaaatgttgttaatatactaaccgaaaaattgatagc |
38691351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University