View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_low_23 (Length: 362)
Name: NF18444_low_23
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 52 - 356
Target Start/End: Complemental strand, 36567414 - 36567110
Alignment:
| Q |
52 |
tctctgtttgaggtggatttgaacatatttagccattctgataaatgttatcttctgaattggactactaaaacataaaacaagtgaagtattttgttga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567414 |
tctctgtttgaggtggatttgaacatatttagccattctgataaatgttatcttctgaattggactactaaaacataaaacaagtgaagtattttgttga |
36567315 |
T |
 |
| Q |
152 |
acctctttttctgtttcaaacggggcttaagaaactttgaagttactggttactggctgacataagatatcaatctactgaagattttccttgtattgaa |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567314 |
acctctttttctgtttcaaacggggcttaagaaactttgaagttactggttactggctgacataagatatcaatctactgaagattttccttgtattgaa |
36567215 |
T |
 |
| Q |
252 |
actttcgccgcagaattagtagaagatgtggatctcttgattaggagagctgagaggtgtttagaagcgggtgcagacatgataatgattgatgctgatg |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567214 |
actttcgccgcagaattagtagaagatgtggatctcttgattaggagagctgagaggtgtttagaagcgggtgcagacatgataatgattgatgctgatg |
36567115 |
T |
 |
| Q |
352 |
atgtc |
356 |
Q |
| |
|
||||| |
|
|
| T |
36567114 |
atgtc |
36567110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 36567489 - 36567447
Alignment:
| Q |
14 |
cacctagatcatatggtaaagatatttcactctctctttctct |
56 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36567489 |
cacctagatcatatggtaaagatatttcactctctctttctct |
36567447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University