View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_low_36 (Length: 290)
Name: NF18444_low_36
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_low_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 18 - 284
Target Start/End: Original strand, 44702503 - 44702774
Alignment:
| Q |
18 |
aataattctatcatgatacacccacagttttggccatttttggaccatctatgaaactatgttttggttttaagattaagcataatttttccttagttcg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44702503 |
aataattctatcatgatacacccacagttttggccatttttggaccatctatgaaactatgttttggttttaagattaagcataatttttccttagttcg |
44702602 |
T |
 |
| Q |
118 |
aagttctcgatgtcccaaatcattttctttcgagggtaagatgattccacttgaccaataaaaacattgataaagcatatcttttactaaaataatttcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44702603 |
aagttctcgatgtcccaaatcattttctttcgagggtaagatgattccacttgaccaataaaaacattgataaagcatatcttttactaaaataatttcc |
44702702 |
T |
 |
| Q |
218 |
attatttttgaaggtttctttaatt-----ttacattacattcatattctctccctttttctttcttctcac |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44702703 |
attatttttgaaggtttctttaatttgacattacaatacattcatattctctccctttttctttcttatcac |
44702774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University