View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_low_38 (Length: 285)
Name: NF18444_low_38
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_low_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 35 - 186
Target Start/End: Original strand, 19894555 - 19894706
Alignment:
| Q |
35 |
tgtatcatagtgttgtgtcattgtatcatttatctataagttggtgataattaaaatctattatctatgttttgattannnnnnnataactatgcactaa |
134 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
19894555 |
tgtatcatagtgatgtgtcattgtatcatttatttataagttggtgataattaaaatctattatatatgttttgattatttttttatagctatgcactaa |
19894654 |
T |
 |
| Q |
135 |
ccatgtttataacttttacatcatttaaataattaacacatttcaaacaaaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19894655 |
ccatgtttataacttttacatcatttaaataattaacacatttcaaacaaaa |
19894706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 241 - 279
Target Start/End: Original strand, 19894767 - 19894805
Alignment:
| Q |
241 |
atctttctagtggttcaaaacaaggatggaagtgttgca |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19894767 |
atctttctagtggttcaaaacaaggatggaagtgttgca |
19894805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University