View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_low_49 (Length: 226)
Name: NF18444_low_49
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_low_49 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 8016755 - 8016561
Alignment:
| Q |
20 |
gctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtccacactcttccctccgggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8016755 |
gctgatgcaatgtcttctgaaatgcgggctgggctttcctccgttgatgggcccgggcttcccatgataccaacttatgtccacactcttccctccgggt |
8016656 |
T |
 |
| Q |
120 |
atgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttattattattgacatgatgatgatgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8016655 |
atgtatgtcgtatgtcatacactaataaatatgttatctctgatgatccactcttccttgtttgttatttttat---tattgacatgatgatgatgat |
8016561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University