View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18444_low_8 (Length: 482)
Name: NF18444_low_8
Description: NF18444
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18444_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 21 - 354
Target Start/End: Complemental strand, 27701646 - 27701313
Alignment:
| Q |
21 |
tgagtatgtgccaccaccattgctgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgat |
120 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701646 |
tgagtatgtgccaccaccattgttgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgat |
27701547 |
T |
|
| Q |
121 |
tatgtcaataggctgaaaaatggtgaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaa |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701546 |
tatgtcaataggctgaaaaatggagaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaa |
27701447 |
T |
|
| Q |
221 |
tttctcattaatttttagggtttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnna |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
27701446 |
tttctcattaatttttagggtttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctcttttttta |
27701347 |
T |
|
| Q |
321 |
ttgacaattaatattctttaatcttggcatgtga |
354 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
27701346 |
ttgaaaattaatattctttaatcttggcatgtga |
27701313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University