View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18445_high_3 (Length: 361)

Name: NF18445_high_3
Description: NF18445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18445_high_3
NF18445_high_3
[»] chr2 (1 HSPs)
chr2 (301-343)||(38883419-38883461)


Alignment Details
Target: chr2 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 301 - 343
Target Start/End: Complemental strand, 38883461 - 38883419
Alignment:
301 caagaagcaacttaacaggtagaaagacaatgaccacaatgct 343  Q
    |||||||||||||||||||||||||||||||||||||||||||    
38883461 caagaagcaacttaacaggtagaaagacaatgaccacaatgct 38883419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University