View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18445_low_11 (Length: 213)
Name: NF18445_low_11
Description: NF18445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18445_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 9451889 - 9451707
Alignment:
| Q |
12 |
tgagaagaacaaacctcctaatgaccttggtgagaatagcgtcggcaacggaatcggcagatgaaattattcaatgagataggaaaagggtcgagagtga |
111 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| ||| |||||||||| |||||||||||||||||||||| ||||| || |
|
|
| T |
9451889 |
tgagaagaacaaaccgcctaacgaccttggtgagaatagtgtcggcaacggaaacggtagatgaaatttttcaatgagataggaaaagggttgagagaga |
9451790 |
T |
 |
| Q |
112 |
agcgacgatgtgaatggtttctcagaggccaaaatatgaaatttaaagaacaccgttaaggccttggaagaaatattgcatag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9451789 |
agcgacgatgtgaatggtttctcagaggccaaaatatgaaatttaaagaacaccgttaaggccttggaagaaatattgcatag |
9451707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University