View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18445_low_11 (Length: 213)

Name: NF18445_low_11
Description: NF18445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18445_low_11
NF18445_low_11
[»] chr4 (1 HSPs)
chr4 (12-194)||(9451707-9451889)


Alignment Details
Target: chr4 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 12 - 194
Target Start/End: Complemental strand, 9451889 - 9451707
Alignment:
12 tgagaagaacaaacctcctaatgaccttggtgagaatagcgtcggcaacggaatcggcagatgaaattattcaatgagataggaaaagggtcgagagtga 111  Q
    ||||||||||||||| ||||| ||||||||||||||||| ||||||||||||| ||| |||||||||| |||||||||||||||||||||| ||||| ||    
9451889 tgagaagaacaaaccgcctaacgaccttggtgagaatagtgtcggcaacggaaacggtagatgaaatttttcaatgagataggaaaagggttgagagaga 9451790  T
112 agcgacgatgtgaatggtttctcagaggccaaaatatgaaatttaaagaacaccgttaaggccttggaagaaatattgcatag 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9451789 agcgacgatgtgaatggtttctcagaggccaaaatatgaaatttaaagaacaccgttaaggccttggaagaaatattgcatag 9451707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University