View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18445_low_3 (Length: 393)
Name: NF18445_low_3
Description: NF18445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18445_low_3 |
 | |
|
| [»] scaffold0232 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 7 - 377
Target Start/End: Original strand, 42392028 - 42392403
Alignment:
| Q |
7 |
acatcatcaaaatgacctagaactaacatccttaaaacaaccttagaaaaggcaagataaacttcaagaagctaagaagggaagccatggaaactgtttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42392028 |
acatcatcaaaatgacctagaactaacatccttaaaactaccttagacaaggcaagataaacttcaagaagctaagaagggaagccatgaaaactgtttg |
42392127 |
T |
|
| Q |
107 |
agaaactggtaaaataaataaaccgcnnnnnnn---aacacaaaccggttctgaaccggacccaaagcaaacctgaactgtttcgtnnnnnnn-ttggtt |
202 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||| ||||||||||||||||||| ||||| |||||| |||||| |||||| |
|
|
| T |
42392128 |
agaaactggtaaaatgaataaaccgcttttttttttaatgcaaaccagttctgaaccggacccaaaacaaacttgaactatttcgtaaaaaaaattggtt |
42392227 |
T |
|
| Q |
203 |
ttttctgaaacagtttaagaaaccaaaccataaattggatatggtttggtttggtttatgaaccatgcacactcctagttataacaacttaacaagaagt |
302 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42392228 |
ttttctgaaacaggttaagaaaccaaaccataaattgaatatggtttggtttgatttatgaaccatgcacactcctagttataacaacttaacaagaagt |
42392327 |
T |
|
| Q |
303 |
atatccattaggtcactcaacacc-tggtatgaacctctttcccgcaacactactaacaatacacatggccatttc |
377 |
Q |
| |
|
||| |||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42392328 |
ataaccattacgtcactcaacaccttggtatgaacctctttcccgcaacactgctaacaatacacatggccatttc |
42392403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 279
Target Start/End: Original strand, 4010590 - 4010623
Alignment:
| Q |
246 |
gtttggtttggtttatgaaccatgcacactccta |
279 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
4010590 |
gtttggtttggtttatgaaccatgcacaccccta |
4010623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0232 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0232
Description:
Target: scaffold0232; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 273
Target Start/End: Complemental strand, 21452 - 21423
Alignment:
| Q |
244 |
tggtttggtttggtttatgaaccatgcaca |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21452 |
tggtttggtttggtttatgaaccatgcaca |
21423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 246 - 287
Target Start/End: Complemental strand, 7528163 - 7528122
Alignment:
| Q |
246 |
gtttggtttggtttatgaaccatgcacactcctagttataac |
287 |
Q |
| |
|
||||||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
7528163 |
gtttggtttggttcatgaatcatgcacacccctagttataac |
7528122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University