View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18445_low_9 (Length: 227)
Name: NF18445_low_9
Description: NF18445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18445_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 47116359 - 47116558
Alignment:
| Q |
7 |
aattcatcatttcgcaaatgatcattgttttccataccatttcgacagtgaacttgtttttgttgttgattgagatgatagtcaatattaattccaaaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47116359 |
aattcatcatttcgcaaatgatcattgttttccataccatttcgacagtgaacttgtttttgttgttgattgtgatgatagtcaatattaattccaaaaa |
47116458 |
T |
 |
| Q |
107 |
gataaaccattgtatcttcctaaaaacttcttcacaaacctatgggcgtacgcgtacttgacaatgaagaagttttgttatactttttaggttaagttga |
206 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116459 |
gataaaccattgtatcttcct-aaaacttcttcacaaacctatgggcgtacgcgtacttgacaatgaagaagttttgttatactttttaggttaagttga |
47116557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University