View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18445_low_9 (Length: 227)

Name: NF18445_low_9
Description: NF18445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18445_low_9
NF18445_low_9
[»] chr3 (1 HSPs)
chr3 (7-207)||(47116359-47116558)


Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 207
Target Start/End: Original strand, 47116359 - 47116558
Alignment:
7 aattcatcatttcgcaaatgatcattgttttccataccatttcgacagtgaacttgtttttgttgttgattgagatgatagtcaatattaattccaaaaa 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
47116359 aattcatcatttcgcaaatgatcattgttttccataccatttcgacagtgaacttgtttttgttgttgattgtgatgatagtcaatattaattccaaaaa 47116458  T
107 gataaaccattgtatcttcctaaaaacttcttcacaaacctatgggcgtacgcgtacttgacaatgaagaagttttgttatactttttaggttaagttga 206  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47116459 gataaaccattgtatcttcct-aaaacttcttcacaaacctatgggcgtacgcgtacttgacaatgaagaagttttgttatactttttaggttaagttga 47116557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University