View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18446_high_7 (Length: 244)
Name: NF18446_high_7
Description: NF18446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18446_high_7 |
 |  |
|
| [»] scaffold0007 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0007 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 17 - 141
Target Start/End: Complemental strand, 149833 - 149709
Alignment:
| Q |
17 |
ctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccacttgaaacatataatggagttgaaataaaagggtttgttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149833 |
ctttttgtggttaaggatgtttcaaattgggtttcaaaaggtgaagaacttgcaccaccacttgaaacatataatggagttgaaataaaagggtttgttc |
149734 |
T |
 |
| Q |
117 |
cacttccacttacaacaatttgttg |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
149733 |
cacttccacttacaacaatttgttg |
149709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 179 - 236
Target Start/End: Complemental strand, 149671 - 149614
Alignment:
| Q |
179 |
attggtcttgttgtttctgttatggattcttcatgttgtggttttggtgatgatgatg |
236 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
149671 |
attggccttgttgtttctattatggattcttcatgttgtggttttggtgatgatgatg |
149614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University