View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18446_high_9 (Length: 230)
Name: NF18446_high_9
Description: NF18446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18446_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 214
Target Start/End: Original strand, 44193865 - 44194059
Alignment:
| Q |
18 |
aaacgaacatcatctttgttatacaagctcaagaaactgcaattaaaaaattgaatcaataaataattagtgagtaaaagaattaagtgagagagagaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44193865 |
aaacgaacatcatctttgttatacaagctcaagaaactgcaattaaaaaattgaatcaataaataattagtgagtaaaagaattaagtgaga--gagaat |
44193962 |
T |
 |
| Q |
118 |
agaagaagagtaacacttacttggtgcataagaggccaagggatttttgtttacggtcgtaagtgtggtgtcgtgaaggaggatcggaggaagaagc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44193963 |
agaagaagagtaacacttacttggtgcataagaggccaagggatttttgtttacggtcgtaagtgtggtgtcgtgaaggaggatcggaggaggaagc |
44194059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 138 - 214
Target Start/End: Complemental strand, 52359082 - 52359006
Alignment:
| Q |
138 |
ttggtgcataagaggccaagggatttttgtttacggtcgtaagtgtggtgtcgtgaaggaggatcggaggaagaagc |
214 |
Q |
| |
|
|||||||| ||||| || | ||| ||||||||||||||||| ||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
52359082 |
ttggtgcacaagagaccgatggaattttgtttacggtcgtatttgtggcgtcgttaaggaggatcggagaaagaagc |
52359006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University