View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18446_low_3 (Length: 373)
Name: NF18446_low_3
Description: NF18446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18446_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 7e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 192 - 356
Target Start/End: Complemental strand, 1332310 - 1332138
Alignment:
| Q |
192 |
gacggatgtcaacacgtgtaaattcatgaatgatgctctttttactgataaagttggaaaggttatgattgacatgttatttaccattgtgtcgacatat |
291 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1332310 |
gacggatgtcaacatgtgtaaattcatgaatgatgctctttttactgataaagttggaaatgttatgattgacatgttatttaccattgtgtcgacatat |
1332211 |
T |
 |
| Q |
292 |
tattttaatatctttcccaaattgtgcctgtgtcatg--------ttgaataaacaattgtgatgcttttgat |
356 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1332210 |
tattttaatatctttcccaaattgtgcctgtgtcatgttataaaattgaataaacaattgtgatgcttttgat |
1332138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 16 - 161
Target Start/End: Complemental strand, 1332485 - 1332340
Alignment:
| Q |
16 |
gagacaggtgttttagggaagctatgaccaaggtttaggaactcaaagtcggagcacacataccctccacatgaggttgagaacgagtgaagtaagacat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1332485 |
gagacaggtgttttagggaagctatgaccagggtttaggaactcaaagtcggagcacacataccctccacatgaggttgaggacgagtgaagtaagacat |
1332386 |
T |
 |
| Q |
116 |
attttcgtgaaagaaaagagctcgagcaacttcaaataaatgatca |
161 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1332385 |
attttcatgaaagaaaagagctcgagcaacttcaaataaatgatca |
1332340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University