View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18447_high_11 (Length: 234)
Name: NF18447_high_11
Description: NF18447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18447_high_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 26642831 - 26643030
Alignment:
| Q |
16 |
gagatatagagtaggggttcgccgtttcaaatttcaatgattctgttttactggttgataatgctgtgcttgaccttatgttggaagttgaagtttttct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642831 |
gagatatagagtaggggttcgccgtttcaaatttcaatgattctgttttactggttgataatgctgtgcttgaccttatgttggaagttgaagtttttct |
26642930 |
T |
|
| Q |
116 |
tgtgctttgatatcatccttgttcaattgcgttgatgaaagtctgatatattattctctgttggagtacagagtttgatctatctgcgggtcgtcctggg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26642931 |
tgtgctttgatatcatccttgttcaattgcgttgatgaaagtctgatatattgttctctgttggagtacagagtttgatctatctgcgggtcgtcctggg |
26643030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 26639343 - 26639548
Alignment:
| Q |
11 |
gagcagagatatagagtaggggttcgccgtttcaaatttcaatgattctgttttactggttgataatgctgtgcttgaccttatgttggaagttgaagtt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26639343 |
gagctgagatatagagtaggggttcgccgcttcaaatttcaatgattctgttttactggttgataatgctgtgcttgaccttatgttggaagttgaagtt |
26639442 |
T |
|
| Q |
111 |
tttctt-gtgctttgatatcatccttgttcaattgcgttgatgaaagtctgatatattattctctgttggagtacagagtttgatctatctgcgggtcgt |
209 |
Q |
| |
|
||| || ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26639443 |
tttttttgtgctttgatatcatccttgttcaattgcgttgatgaaagtctgatatactattctctgttggagtacagagtttgatctatctgcgggtcgt |
26639542 |
T |
|
| Q |
210 |
cctggg |
215 |
Q |
| |
|
|||||| |
|
|
| T |
26639543 |
cctggg |
26639548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University