View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18447_high_5 (Length: 408)
Name: NF18447_high_5
Description: NF18447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18447_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 12 - 315
Target Start/End: Original strand, 49862076 - 49862370
Alignment:
| Q |
12 |
atgaaccagtctgtatcggaattttcttcttcttgttcttcctcatgttctgatgagaagcaatcttcattggttgacattaccgttgagattccgagaa |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49862076 |
atgaaccggtctgtatcggaattttcttcttcttgttcttcctcatgttctgatgagaagcaatcttcatcggttgacattaccgttgagattccgagaa |
49862175 |
T |
 |
| Q |
112 |
ggagtgaatccgattgcaagagttttgctgtgggagagtcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49862176 |
ggagtgaatccgattgcaagagttttgctgtgggagagtcgagttgtgattcaccatcatcgtttcggtcaccaatgagtcgtgttttgtcgttcacgag |
49862275 |
T |
 |
| Q |
212 |
aatccttagcagagagaggaaaccaagcatttctccgtcgttggattgtgccgcagatgcagaatgaggtgaaagggaggagactcagtgagttgattga |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
49862276 |
aatccttagcagagagaggaaaccaagcatttctccgtcgttggattg---------tgcagaacgaggtgaaagggaggagactcggtgagttgattga |
49862366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University