View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18448_low_4 (Length: 359)
Name: NF18448_low_4
Description: NF18448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18448_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 45 - 217
Target Start/End: Original strand, 28190911 - 28191082
Alignment:
| Q |
45 |
attgattgcacactcatcttcatcttttaactaattgactcctaaagagatatcttgtaactaattgacaaataataaccaacatttattcatgtgtgta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
28190911 |
attgattgcacactcatcttcatcttttaactaattgactcctaaagagatatcttgtaactaattgacaaataataaccaacatttattcacgtgtgta |
28191010 |
T |
 |
| Q |
145 |
ggatttagaattgaaatagatttgttcacgtaagaactataaaccttccttctttaacaaatatctaactttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
28191011 |
ggatttagaattgaaatagatttgttcacgtaagaactataacccttccttcttt-acaaatatctaactttt |
28191082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 305 - 349
Target Start/End: Original strand, 28191174 - 28191218
Alignment:
| Q |
305 |
cttggtatagactttgtcaaaaaatactcaaatgcagacattcat |
349 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28191174 |
cttggtatagactttgtcaaaaagtactcaaatgcagacattcat |
28191218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University