View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1844_high_2 (Length: 210)
Name: NF1844_high_2
Description: NF1844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1844_high_2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 40227689 - 40227492
Alignment:
| Q |
13 |
attctcttcaggggggatccacgggcgaggtctttttgtctcgacgtgattcaatggtccagatttgaagacctttcatttgtgctgacccgtcgaaatc |
112 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |||||||| |||||| ||||||||||||||| |
|
|
| T |
40227689 |
attctcttcaagggggatccacaggcgaggtctttttatctcgacgtgattcaatggtccagatttgacgacctttcgtttgtgttgacccgtcgaaatc |
40227590 |
T |
 |
| Q |
113 |
gtggcgttttatgccatgtgccaccaattgctgccgaggctagcgggattcctgaggcgacattaatgctaggttataaaagggggttgtggttagca |
210 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40227589 |
gtggcgttttatgccacgtgccaccaatcactgtcgaggctagcgggattcctgaggcgacattaatgctaggttataaaaggggtttgtggttagca |
40227492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University