View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18451_high_7 (Length: 371)
Name: NF18451_high_7
Description: NF18451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18451_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 92; Significance: 1e-44; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 116 - 223
Target Start/End: Complemental strand, 33398416 - 33398309
Alignment:
| Q |
116 |
ctattaagaattcacatgattaaatcttaagctcataagtatcacatccgtgaagatgtctacccttcatgctgatatcaaagccgcgatgagatgcttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33398416 |
ctattaagaattcacatgattaaatcttaagctcataagcatcacatccgtgaagatgtctatccttcatgctgatatcaaagccgcgatgcgatgcttt |
33398317 |
T |
|
| Q |
216 |
ctggagac |
223 |
Q |
| |
|
|| ||||| |
|
|
| T |
33398316 |
ctagagac |
33398309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 18 - 90
Target Start/End: Complemental strand, 33398489 - 33398417
Alignment:
| Q |
18 |
caagcatggattgatgaaattaaaggtgatacaattgacgaaattgaagactttcaaatcacaccttcaagaa |
90 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398489 |
caagcatggattgatgaaattaaaggtcatacaattgacgaaattgaagactttcaaatcacaccttcaagaa |
33398417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 222 - 316
Target Start/End: Complemental strand, 33398276 - 33398170
Alignment:
| Q |
222 |
acgttttctcaaaatccaaagaattctctatttttctctttactcctcccc------------tcttcaaactcgtaaacaaagcgaaagggttttgttt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398276 |
acgttttctcaaaatccaaagaattctctatttttctctttactcctccccacatacctcccctcttcaaactcgtaaacaaagcgaaagggttttgttt |
33398177 |
T |
|
| Q |
310 |
ggtgttg |
316 |
Q |
| |
|
||||||| |
|
|
| T |
33398176 |
ggtgttg |
33398170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 316 - 363
Target Start/End: Complemental strand, 33398136 - 33398089
Alignment:
| Q |
316 |
gataaagcacgttcctcttcatcaattcaaggtcttgctctttcatat |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33398136 |
gataaagcacgttcctcttcatcaattcaaggtcttgctctttcatat |
33398089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University