View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18451_low_8 (Length: 270)
Name: NF18451_low_8
Description: NF18451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18451_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 15 - 151
Target Start/End: Complemental strand, 9370013 - 9369877
Alignment:
| Q |
15 |
ggcagcaaaatcctcaactattcctgcggatatttggtcgtagaaacttccgcaggaaatttgcagaattctagtagtgttttaacgaattatcgacgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9370013 |
ggcagcaaaatcctcaactattcctgcggatatttggtcgtagaaacttccgcaggaaatttgcagaattctagtagtgttttaacgaattatcgacgtg |
9369914 |
T |
 |
| Q |
115 |
gagtcatgcaaaaccaaacaaaagtagacgtgagaaa |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9369913 |
gagtcatgcaaaaccaaacaaaagtagacgtgagaaa |
9369877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 240 - 270
Target Start/End: Complemental strand, 9369788 - 9369758
Alignment:
| Q |
240 |
gcccattgaaattaacacgaaagaattgaac |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9369788 |
gcccattgaaattaacacgaaagaattgaac |
9369758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University