View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18452_low_14 (Length: 321)
Name: NF18452_low_14
Description: NF18452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18452_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 16 - 312
Target Start/End: Original strand, 24042564 - 24042860
Alignment:
| Q |
16 |
gtgctggtggtgagcttttcgatagaattattcagagagggcattatagtgaaagaaaagcttctgaacttactaggttgattttaggtgttgttcaagc |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042564 |
gtgctggtggtgagcttttcgataggattatacagagagggcattatagtgaaagaaaagcttctgaacttactaggttgattttaggtgttgttcaagc |
24042663 |
T |
|
| Q |
116 |
ttgtcattctttaggggttatgcatagagatttgaagccggaaaattttctgtttgttagtgatgatgaagaatcagcacttaagacgattgattttgga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042664 |
ttgtcattctttaggggttatgcatagagatttgaagccggaaaattttctgtttgttagtcatgatgaagaatcagcacttaagacgattgattttgga |
24042763 |
T |
|
| Q |
216 |
ctctcggtgttttttagaccaggtatattcaatttatttgttttgtcattttggcaatattattgttctggttgatcagttgaatgaaaatgatgat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24042764 |
ctctcggtgttttttagaccaggtatattcaatttatttgttttgtcattttggcaacattattgttctggttgatcagttgaatgaaaatgatgat |
24042860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 16 - 174
Target Start/End: Original strand, 18400046 - 18400204
Alignment:
| Q |
16 |
gtgctggtggtgagcttttcgatagaattattcagagagggcattatagtgaaagaaaagcttctgaacttactaggttgattttaggtgttgttcaagc |
115 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||| | || ||||||| ||||||||| || ||||||||| |||| || | ||||||||| |||| |
|
|
| T |
18400046 |
gtgcaggtggtgagcttttcgatcggattattcagcgcggacattatactgaaagaaaggcggctgaacttattaggactatagttggtgttgttgaagc |
18400145 |
T |
|
| Q |
116 |
ttgtcattctttaggggttatgcatagagatttgaagccggaaaattttctgtttgtta |
174 |
Q |
| |
|
||||||||| | || || ||||||||||| | ||||| || |||||||| ||||||| |
|
|
| T |
18400146 |
ctgtcattctcttggtgtgatgcatagagaccttaagcccgagaattttctctttgtta |
18400204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University