View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18452_low_17 (Length: 277)
Name: NF18452_low_17
Description: NF18452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18452_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 44166574 - 44166737
Alignment:
| Q |
19 |
taggtggtgtcaaagtgcttccatggcattttcttttcattctcgccgtgggacacaaccaacgcatatacaccgccttccata-ccccacatcggcatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44166574 |
taggtggtgtcaaagtgcttccatggcattttcttttcattctcgccgcgggacacaaccaacgcatatacaccgccttccatacccccacatcggcatc |
44166673 |
T |
 |
| Q |
118 |
gtcgtattc-gttcatactgccgtcgaatctgtcgtcaacctccttattgcatgcattagccatttgttttgtgac |
192 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44166674 |
gtcgtattcttttcata------------ctgtcgtcaacctccttattgcatgcattagccatttgttttgtgac |
44166737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 137 - 254
Target Start/End: Complemental strand, 38304173 - 38304056
Alignment:
| Q |
137 |
ccgtcgaatctgtcgtcaacctccttattgcatgcattagccatttgttttgtgacacgtgagactcaatgaagaggtggggtaattaaatgtctaagcc |
236 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38304173 |
ccgtcgaatctgtgatgaacctccttattgcatgcattagccatttgttttatgacacgtgagactgaatgaagaggtggggtaattaaatgtctaagct |
38304074 |
T |
 |
| Q |
237 |
ttccaactaataaaaaat |
254 |
Q |
| |
|
|||| | | ||||||||| |
|
|
| T |
38304073 |
ttcccattgataaaaaat |
38304056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 60 - 104
Target Start/End: Complemental strand, 38304288 - 38304244
Alignment:
| Q |
60 |
ctcgccgtgggacacaaccaacgcatatacaccgccttccatacc |
104 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
38304288 |
ctcgccgcgggacacaaccaacccatatacatcgccttccatacc |
38304244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University